G718945



Basic Information


Item Value
gene id G718945
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 50525475 ~ 50525714 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU816849
ctcatcaggagcatgcccaggcattgccacacacactactgagcctcattttgacttgttttaaggacattacatcaaagttggatcagcctgtagtgtggttttccactttaattttgagtgtgactccaaatcaagacctccatgggttgataaatttgatttccattaatcatttttgtgtgattttgttgtcagcacattcaactatgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU816849 True 213 lncRNA 0.39 2 50525475 50525714
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530021 LOC106568720 coding downstream 90687 50412980 ~ 50434788 (-)
LOC110530016 LOC106568717 coding downstream 159205 50337731 ~ 50366270 (-)
LOC110530015 LOC106568800 coding downstream 429546 50093497 ~ 50095929 (-)
LOC118965625 NA coding downstream 539270 49983389 ~ 49986205 (-)
LOC110530012 LOC106568711 coding downstream 555393 49964914 ~ 49970082 (-)
LOC110530027 LOC106568725 coding upstream 139917 50665631 ~ 50674317 (-)
LOC110530028 LOC106568726 coding upstream 152458 50678172 ~ 50685258 (-)
hsd17b7 LOC106568727 coding upstream 164633 50690347 ~ 50710421 (-)
LOC110530033 LOC106568728 coding upstream 190414 50716128 ~ 50729934 (-)
LOC110530034 LOC106568730 coding upstream 215262 50740976 ~ 50767911 (-)
G718834 NA non-coding downstream 72642 50357313 ~ 50452833 (-)
G718798 LOC106598425 non-coding downstream 142384 50297400 ~ 50383091 (-)
G718784 NA non-coding downstream 274419 50250751 ~ 50251056 (-)
G718783 NA non-coding downstream 275359 50249858 ~ 50250116 (-)
G718781 NA non-coding downstream 283581 50241664 ~ 50241894 (-)
G718986 NA non-coding upstream 45594 50571308 ~ 50571740 (-)
G718931 NA non-coding upstream 162526 50688240 ~ 50714007 (-)
G719056 NA non-coding upstream 188868 50714582 ~ 50714934 (-)
G719068 NA non-coding upstream 208363 50734077 ~ 50734533 (-)
LOC110530011 LOC106568709 other downstream 636223 49866272 ~ 49937001 (-)
G718489 NA other downstream 687779 49785674 ~ 49837696 (-)
G716488 NA other downstream 1736513 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 1742960 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 1764312 48759912 ~ 48761163 (-)
G719151 NA other upstream 411214 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 726641 51252355 ~ 51259061 (-)
G721275 NA other upstream 2235325 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 2937468 53462034 ~ 53478913 (-)
G722459 NA other upstream 2972434 53495804 ~ 53499730 (-)

Expression


G718945 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G718945 Expression in each Bioproject

Bar chart with 11 bars.
G718945 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network