G718986



Basic Information


Item Value
gene id G718986
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 50571308 ~ 50571740 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU816897
CATAACAACGCATAGCAATGTTGGCTGCTGCTTTGTTGTATTAATAAAGGAGAAGCGTTTGGGGGATGGCTTGTTGCAGTGGAGCTGAAGCGACCTCTCTCGAGGCGCTACATGTTAGCGTCACGGGGTGTGTGCCGCTGACCGTGTGTATCTGCGGCTAACCGTGTGTTTTTCCACACATTGCCTCAGCTCTATTCTCTATGAGGCGTAGGAAGATGATTTGCCTCGACCTGACAGAAAAAGATGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU816897 True 247 lncRNA 0.50 2 50571308 50571740

Neighbor


gene id symbol gene type direction distance location
LOC110530021 LOC106568720 coding downstream 136520 50412980 ~ 50434788 (-)
LOC110530016 LOC106568717 coding downstream 205038 50337731 ~ 50366270 (-)
LOC110530015 LOC106568800 coding downstream 475379 50093497 ~ 50095929 (-)
LOC118965625 NA coding downstream 585103 49983389 ~ 49986205 (-)
LOC110530012 LOC106568711 coding downstream 601226 49964914 ~ 49970082 (-)
LOC110530027 LOC106568725 coding upstream 93891 50665631 ~ 50674317 (-)
LOC110530028 LOC106568726 coding upstream 106432 50678172 ~ 50685258 (-)
hsd17b7 LOC106568727 coding upstream 118607 50690347 ~ 50710421 (-)
LOC110530033 LOC106568728 coding upstream 144388 50716128 ~ 50729934 (-)
LOC110530034 LOC106568730 coding upstream 169236 50740976 ~ 50767911 (-)
G718945 NA non-coding downstream 45594 50525475 ~ 50525714 (-)
G718834 NA non-coding downstream 118475 50357313 ~ 50452833 (-)
G718798 LOC106598425 non-coding downstream 188217 50297400 ~ 50383091 (-)
G718784 NA non-coding downstream 320252 50250751 ~ 50251056 (-)
G718783 NA non-coding downstream 321192 50249858 ~ 50250116 (-)
G718931 NA non-coding upstream 116500 50688240 ~ 50714007 (-)
G719056 NA non-coding upstream 142842 50714582 ~ 50714934 (-)
G719068 NA non-coding upstream 162337 50734077 ~ 50734533 (-)
G719069 NA non-coding upstream 164519 50736259 ~ 50738316 (-)
LOC110530011 LOC106568709 other downstream 682056 49866272 ~ 49937001 (-)
G718489 NA other downstream 733612 49785674 ~ 49837696 (-)
G716488 NA other downstream 1782346 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 1788793 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 1810145 48759912 ~ 48761163 (-)
G719151 NA other upstream 365188 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 680615 51252355 ~ 51259061 (-)
G721275 NA other upstream 2189299 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 2891442 53462034 ~ 53478913 (-)
G722459 NA other upstream 2926408 53495804 ~ 53499730 (-)

Expression


G718986 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G718986 Expression in each Bioproject

Bar chart with 10 bars.
G718986 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network