G719056



Basic Information


Item Value
gene id G719056
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 50714582 ~ 50714934 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU816971
gtctaattgatcattagaaaacccttttgcaattatgttagcacagctgaaaactgttgtcctgaataaagaagcaataaaactggccttctttagactagttgagtatctggagcatcagcatttgtgagtttgattacatgctcaaaatggacataaacaaagacctttcttctgaaagtcatcagtctattcttgttctgagaaatgaaggctattccatgcgagaaattgccaagaaactgaagatctcgttcaacgctgtgtactactcccttcacagaacagtgcaaactgtctccaaccagaatagaaagaggagtgggaggccccggtgcacaactgagcaagag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU816971 True 353 lncRNA 0.41 1 50714582 50714934
Loading

Neighbor


gene id symbol gene type direction distance location
hsd17b7 LOC106568727 coding downstream 4161 50690347 ~ 50710421 (-)
LOC110530028 LOC106568726 coding downstream 29324 50678172 ~ 50685258 (-)
LOC110530027 LOC106568725 coding downstream 40265 50665631 ~ 50674317 (-)
LOC110530021 LOC106568720 coding downstream 279794 50412980 ~ 50434788 (-)
LOC110530016 LOC106568717 coding downstream 348312 50337731 ~ 50366270 (-)
LOC110530033 LOC106568728 coding upstream 1194 50716128 ~ 50729934 (-)
LOC110530034 LOC106568730 coding upstream 26042 50740976 ~ 50767911 (-)
LOC110530035 LOC106568731 coding upstream 76286 50791220 ~ 50793594 (-)
LOC110530036 LOC106568732 coding upstream 119606 50834540 ~ 50848805 (-)
LOC110530040 LOC106568735 coding upstream 317631 51032565 ~ 51067801 (-)
G718931 NA non-coding downstream 575 50688240 ~ 50714007 (-)
G718986 NA non-coding downstream 142842 50571308 ~ 50571740 (-)
G718945 NA non-coding downstream 188868 50525475 ~ 50525714 (-)
G718834 NA non-coding downstream 261749 50357313 ~ 50452833 (-)
G718798 LOC106598425 non-coding downstream 331491 50297400 ~ 50383091 (-)
G719068 NA non-coding upstream 19143 50734077 ~ 50734533 (-)
G719069 NA non-coding upstream 21325 50736259 ~ 50738316 (-)
G719114 NA non-coding upstream 103848 50818782 ~ 50818987 (-)
G719202 NA non-coding upstream 240535 50955469 ~ 50957241 (-)
LOC110530011 LOC106568709 other downstream 825330 49866272 ~ 49937001 (-)
G718489 NA other downstream 876886 49785674 ~ 49837696 (-)
G716488 NA other downstream 1925620 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 1932067 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 1953419 48759912 ~ 48761163 (-)
G719151 NA other upstream 221994 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 537421 51252355 ~ 51259061 (-)
G721275 NA other upstream 2046105 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 2748248 53462034 ~ 53478913 (-)
G722459 NA other upstream 2783214 53495804 ~ 53499730 (-)

Expression


G719056 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G719056 Expression in each Bioproject

Bar chart with 20 bars.
G719056 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network