G719697



Basic Information


Item Value
gene id G719697
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51224529 ~ 51224765 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU817681
gccagtccatagcatcaatgccttcctcttgcaggaactgctgacacactccagccacatgaggtctagcattgtcttgcattaggaggaacccagggccaaccgcaccagcatatggtctcacaaggggtctgaggatctcctctcggtacctaatggcagtcaggctacctctggcgagcacatggagggctgtgcggccccccaaagaaatgccaccccacaccatgactgacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU817681 True 237 lncRNA 0.57 1 51224529 51224765
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530042 kcnt2 coding downstream 34917 51127614 ~ 51189612 (-)
LOC110530040 LOC106568735 coding downstream 156728 51032565 ~ 51067801 (-)
LOC110530036 LOC106568732 coding downstream 375724 50834540 ~ 50848805 (-)
LOC110530035 LOC106568731 coding downstream 430935 50791220 ~ 50793594 (-)
LOC110530034 LOC106568730 coding downstream 456618 50740976 ~ 50767911 (-)
LOC110530043 LOC106568739 coding upstream 27590 51252355 ~ 51259061 (-)
LOC110530045 LOC106568741 coding upstream 91529 51316294 ~ 51323600 (-)
LOC110530046 LOC106568804 coding upstream 153139 51377904 ~ 51380863 (-)
mfsd8l2 LOC106568744 coding upstream 271315 51496080 ~ 51516909 (-)
LOC110530051 LOC106568746 coding upstream 300502 51525267 ~ 51546934 (-)
G719696 LOC106613263 non-coding downstream 123 51223886 ~ 51224406 (-)
G719276 NA non-coding downstream 99952 51124344 ~ 51124577 (-)
G719274 NA non-coding downstream 105043 51119235 ~ 51119486 (-)
G719263 NA non-coding downstream 117850 51106439 ~ 51106679 (-)
G719701 NA non-coding upstream 3323 51228088 ~ 51228302 (-)
G719702 NA non-coding upstream 3636 51228401 ~ 51228671 (-)
G719761 NA non-coding upstream 87124 51311889 ~ 51312674 (-)
G719762 NA non-coding upstream 88543 51313308 ~ 51313537 (-)
G719767 NA non-coding upstream 103441 51328206 ~ 51328432 (-)
G719151 NA other downstream 285058 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1335277 49866272 ~ 49937001 (-)
G718489 NA other downstream 1386833 49785674 ~ 49837696 (-)
G716488 NA other downstream 2435567 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 2442014 48782121 ~ 48782515 (-)
G721275 NA other upstream 1536274 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 2238417 53462034 ~ 53478913 (-)
G722459 NA other upstream 2273383 53495804 ~ 53499730 (-)
G722602 NA other upstream 2578678 53803443 ~ 53856065 (-)

Expression


G719697 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G719697 Expression in each Bioproject

Bar chart with 19 bars.
G719697 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network