G719835 (LOC106568743)



Basic Information


Item Value
gene id G719835
gene name LOC106568743
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51438954 ~ 51439395 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU817833
TCGAGCACTTCTTGAAGAAAACCCGCACGGATATCAAGGACATACAAGCCCCCAGGTCCTGAAAGGCCAGGTAGAAGCCGGCCTTGGAAATAGGGCCAAAGCTTCTCACTTTGGTGTTGATCCTGCCTGCCTCGAGCAAGGAAAAACTCTCATCAGGGGCAATGGTGTCAACTTTGACATAAGGGGTCTCCCTCCACAAGGGACTACTTTCCGTAGCGGTATCGCCATCAGACTCGTAGTAGAAGAGGTTAAAGGTCTCCTTGCAGGAGCCGGGGATGTTGGGAATACTGGCACAGTCACGGACGGAGAACTTGAGCTCCACGTAGACGCGCAGCACGCCCTTACGGGGGATGAAGTCCGTCCTCAGCCAATTGTTCTGGTTGGGTTCGCGCACATTGCACACCTGGTATGTCCTGATAGGACTCATTGAATCGTCGTAGCC

Function


NR:

description
ephrin type-B receptor 3-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU817833 True 442 lncRNA 0.54 1 51438954 51439395
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530046 LOC106568804 coding downstream 58091 51377904 ~ 51380863 (-)
LOC110530045 LOC106568741 coding downstream 115354 51316294 ~ 51323600 (-)
LOC110530043 LOC106568739 coding downstream 179893 51252355 ~ 51259061 (-)
LOC110530042 kcnt2 coding downstream 249342 51127614 ~ 51189612 (-)
LOC110530040 LOC106568735 coding downstream 371153 51032565 ~ 51067801 (-)
mfsd8l2 LOC106568744 coding upstream 56685 51496080 ~ 51516909 (-)
LOC110530051 LOC106568746 coding upstream 85872 51525267 ~ 51546934 (-)
LOC110530052 LOC106568747 coding upstream 121405 51560800 ~ 51582355 (-)
LOC110530053 LOC106568748 coding upstream 144130 51583525 ~ 51591883 (-)
si:dkey-18p12.4 LOC106568750 coding upstream 209143 51648538 ~ 51689345 (-)
G719767 NA non-coding downstream 110522 51328206 ~ 51328432 (-)
G719762 NA non-coding downstream 125417 51313308 ~ 51313537 (-)
G719761 NA non-coding downstream 126280 51311889 ~ 51312674 (-)
G719702 NA non-coding downstream 210283 51228401 ~ 51228671 (-)
G719841 LOC106568743 non-coding upstream 5825 51445220 ~ 51445520 (-)
G719842 NA non-coding upstream 7344 51446739 ~ 51446984 (-)
G719854 NA non-coding upstream 26581 51465976 ~ 51466228 (-)
G719886 LOC106568745 non-coding upstream 71892 51511287 ~ 51575248 (-)
G719151 NA other downstream 499483 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1549702 49866272 ~ 49937001 (-)
G718489 NA other downstream 1601258 49785674 ~ 49837696 (-)
G716488 NA other downstream 2649992 48788521 ~ 48788962 (-)
G721275 NA other upstream 1321644 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 2023787 53462034 ~ 53478913 (-)
G722459 NA other upstream 2058753 53495804 ~ 53499730 (-)
G722602 NA other upstream 2364048 53803443 ~ 53856065 (-)
G722670 NA other upstream 2486833 53926228 ~ 53927959 (-)

Expression


G719835(LOC106568743) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

G719835(LOC106568743) Expression in each Bioproject

Bar chart with 5 bars.
G719835(LOC106568743) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.

Co-expression Network