G719970



Basic Information


Item Value
gene id G719970
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51640369 ~ 51640659 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU817973
gttcagtgtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtacaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU817973 True 291 lncRNA 0.42 1 51640369 51640659
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530053 LOC106568748 coding downstream 48486 51583525 ~ 51591883 (-)
LOC110530052 LOC106568747 coding downstream 58014 51560800 ~ 51582355 (-)
LOC110530051 LOC106568746 coding downstream 93435 51525267 ~ 51546934 (-)
mfsd8l2 LOC106568744 coding downstream 123460 51496080 ~ 51516909 (-)
LOC110530046 LOC106568804 coding downstream 259506 51377904 ~ 51380863 (-)
si:dkey-18p12.4 LOC106568750 coding upstream 7879 51648538 ~ 51689345 (-)
eif4a2 LOC106568752 coding upstream 101555 51742214 ~ 51751447 (-)
LOC118965688 NA coding upstream 103218 51743877 ~ 51744055 (-)
LOC118965689 NA coding upstream 108565 51749224 ~ 51749294 (-)
LOC118965644 NA coding upstream 109091 51749750 ~ 51749819 (-)
G719930 NA non-coding downstream 52177 51587952 ~ 51588192 (-)
G719886 LOC106568745 non-coding downstream 65121 51511287 ~ 51575248 (-)
G719854 NA non-coding downstream 174141 51465976 ~ 51466228 (-)
G719842 NA non-coding downstream 193385 51446739 ~ 51446984 (-)
G719981 NA non-coding upstream 41472 51682131 ~ 51686715 (-)
G719992 NA non-coding upstream 65798 51706457 ~ 51706712 (-)
G719993 NA non-coding upstream 67131 51707790 ~ 51708111 (-)
G719994 NA non-coding upstream 67646 51708305 ~ 51708550 (-)
G720003 NA non-coding upstream 75808 51716467 ~ 51716743 (-)
LOC110530043 LOC106568739 other downstream 381350 51252355 ~ 51259061 (-)
G719151 NA other downstream 700898 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1751117 49866272 ~ 49937001 (-)
G718489 NA other downstream 1802673 49785674 ~ 49837696 (-)
G716488 NA other downstream 2851407 48788521 ~ 48788962 (-)
G721275 NA other upstream 1120380 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 1822523 53462034 ~ 53478913 (-)
G722459 NA other upstream 1857489 53495804 ~ 53499730 (-)
G722602 NA other upstream 2162784 53803443 ~ 53856065 (-)
G722670 NA other upstream 2285569 53926228 ~ 53927959 (-)

Expression


G719970 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G719970 Expression in each Bioproject

Bar chart with 20 bars.
G719970 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network