G719994



Basic Information


Item Value
gene id G719994
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51708305 ~ 51708550 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU818002
GTGTATTGTCAATTATGACCATGAAGGATACCCTGGCATCATCATGGATGTAGAGGAACATAAGATTAAGGTGAAGTGCACGCACCAGAATGGCATCAACAAATTATTCTGGCCAAGTCCAAAGGAAGATGTTTGTTTTTACTCTGATGGACAGATCATTTGTCTGATGCCAGAGCAACAGGCTGTTAATAAACAATATATACAGACGGAAAAATCCACCTGGAAGTATGTGGAAGAGCATTTGGG

Function


NR:

description
PREDICTED: uncharacterized protein LOC108426002

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU818002 True 246 lncRNA 0.41 1 51708305 51708550

Neighbor


gene id symbol gene type direction distance location
si:dkey-18p12.4 LOC106568750 coding downstream 18960 51648538 ~ 51689345 (-)
LOC110530053 LOC106568748 coding downstream 116422 51583525 ~ 51591883 (-)
LOC110530052 LOC106568747 coding downstream 125950 51560800 ~ 51582355 (-)
LOC110530051 LOC106568746 coding downstream 161371 51525267 ~ 51546934 (-)
mfsd8l2 LOC106568744 coding downstream 191396 51496080 ~ 51516909 (-)
eif4a2 LOC106568752 coding upstream 33664 51742214 ~ 51751447 (-)
LOC118965688 NA coding upstream 35327 51743877 ~ 51744055 (-)
LOC118965689 NA coding upstream 40674 51749224 ~ 51749294 (-)
LOC118965644 NA coding upstream 41200 51749750 ~ 51749819 (-)
LOC118965691 NA coding upstream 41560 51750110 ~ 51750180 (-)
G719993 NA non-coding downstream 194 51707790 ~ 51708111 (-)
G719992 NA non-coding downstream 1593 51706457 ~ 51706712 (-)
G719981 NA non-coding downstream 21590 51682131 ~ 51686715 (-)
G719970 NA non-coding downstream 67646 51640369 ~ 51640659 (-)
G719930 NA non-coding downstream 120113 51587952 ~ 51588192 (-)
G720003 NA non-coding upstream 7917 51716467 ~ 51716743 (-)
G720009 NA non-coding upstream 13123 51721673 ~ 51721970 (-)
G720112 NA non-coding upstream 50733 51759283 ~ 51763591 (-)
G720399 LOC106568761 non-coding upstream 346680 52055230 ~ 52059713 (-)
G720409 NA non-coding upstream 364215 52072765 ~ 52073121 (-)
LOC110530043 LOC106568739 other downstream 449286 51252355 ~ 51259061 (-)
G719151 NA other downstream 768834 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 1819053 49866272 ~ 49937001 (-)
G718489 NA other downstream 1870609 49785674 ~ 49837696 (-)
G716488 NA other downstream 2919343 48788521 ~ 48788962 (-)
G721275 NA other upstream 1052489 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 1754632 53462034 ~ 53478913 (-)
G722459 NA other upstream 1789598 53495804 ~ 53499730 (-)
G722602 NA other upstream 2094893 53803443 ~ 53856065 (-)
G722670 NA other upstream 2217678 53926228 ~ 53927959 (-)

Expression


G719994 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G719994 Expression in each Bioproject

Bar chart with 16 bars.
G719994 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network