G720449



Basic Information


Item Value
gene id G720449
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52110669 ~ 52110983 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU818499
caggtgggaaaaggggtgacgaggtagttaggaggagacaaggaacagctgggggaaagagggggagaaaaggtaacctaataacgaccagcagagggagacagggtgaagggaaaggacagaaacaagacacaacatgacaatacatgacagtacccccccactcaccgagcgccacctggcgcactcgaggaggaaacctggcggcaacggaggaaatcatcgatcagcgcacggtccagcacgtcccgagagggaacccaactcctctcctcaggaccgtacccctcccaatctactaggtactgatgacca

Function


NR:

description
PREDICTED: uncharacterized protein LOC109108415

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU818499 True 315 lncRNA 0.56 1 52110669 52110983
Loading

Neighbor


gene id symbol gene type direction distance location
cmpk LOC106568761 coding upstream 50946 52053382 ~ 52059723 (+)
LOC110530067 LOC106568759 coding upstream 61899 52030973 ~ 52048770 (+)
LOC110530065 s22bb coding upstream 86709 52019740 ~ 52023960 (+)
zgc:153115 LOC106568757 coding upstream 122342 51982632 ~ 51988327 (+)
LOC110530063 LOC106568806 coding upstream 198376 51902098 ~ 51912293 (+)
dis3l2 dis3l2 coding downstream 119695 52230678 ~ 52248262 (+)
LOC110530076 LOC106568765 coding downstream 144151 52255134 ~ 52282393 (+)
agxtb agxt coding downstream 337288 52448271 ~ 52459617 (+)
trnap-ugg-10 NA coding downstream 654518 52765413 ~ 52765655 (+)
LOC110530086 LOC106568992 coding downstream 660952 52771935 ~ 52775359 (+)
G720448 NA non-coding upstream 874 52109575 ~ 52109795 (+)
G720443 NA non-coding upstream 3964 52106502 ~ 52106705 (+)
G720301 NA non-coding upstream 41018 52069100 ~ 52069651 (+)
G720207 NA non-coding upstream 192443 51916895 ~ 51918226 (+)
G720021 LOC106568752 non-coding upstream 360506 51748697 ~ 51750163 (+)
G720466 NA non-coding downstream 14123 52125106 ~ 52125602 (+)
G720467 NA non-coding downstream 15117 52126100 ~ 52126533 (+)
G720468 NA non-coding downstream 16431 52127414 ~ 52127852 (+)
G720472 NA non-coding downstream 18336 52129319 ~ 52129600 (+)
G720473 NA non-coding downstream 18902 52129885 ~ 52130114 (+)
LOC110530024 LOC106568723 other upstream 1469503 50607401 ~ 50641183 (+)
LOC110530019 LOC106568718 other upstream 1716833 50384296 ~ 50397007 (+)
LOC118965615 NA other upstream 2256477 49853027 ~ 49854435 (+)
G716993 LOC100136012 other upstream 2563584 49546212 ~ 49547085 (+)
G716862 NA other upstream 2776897 49332841 ~ 49333772 (+)
G721689 LOC106583873 other downstream 1266249 53377232 ~ 53377705 (+)
mrpl34 mrpl34 other downstream 1559413 53670348 ~ 53674103 (+)
rps28 NA other downstream 1815234 53926018 ~ 53927959 (+)
LOC118965528 LOC106568937 other downstream 2513191 54557953 ~ 54670115 (+)
LOC110530153 LOC106568927 other downstream 3023047 55120291 ~ 55136638 (+)

Expression


G720449 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G720449 Expression in each Bioproject

Bar chart with 11 bars.
G720449 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network