G721245



Basic Information


Item Value
gene id G721245
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52533209 ~ 52668446 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU819453
acttgattggagtccacctgtggtaaattcaaatgattggtcatttctgcagcattgaaggtacccaagaacagagtggcttccatcactcttaaatagaagaagtttggaaccaccaagcctcttccaagttccggcggcacacgataattcccggcttctcatgtctaccacacataatatcccaaatttagtaccacagaaagagccataatacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU819453 True 218 lncRNA 0.44 2 52533209 52668446
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-uac-6 NA coding downstream 394 52532743 ~ 52532815 (-)
trnav-uac-5 NA coding downstream 596 52532541 ~ 52532613 (-)
trnav-cac-25 NA coding downstream 781 52532356 ~ 52532428 (-)
trnav-aac-47 NA coding downstream 1751 52531386 ~ 52531458 (-)
trnav-aac-46 NA coding downstream 1953 52531184 ~ 52531256 (-)
trnav-aac-134 NA coding upstream 799 52669245 ~ 52669317 (-)
trnav-aac-135 NA coding upstream 2281 52670727 ~ 52670799 (-)
trnav-cac-46 NA coding upstream 3587 52672033 ~ 52672105 (-)
trnav-aac-136 NA coding upstream 3789 52672235 ~ 52672307 (-)
trnav-cac-47 NA coding upstream 5095 52673541 ~ 52673613 (-)
G721235 NA non-coding downstream 42806 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 73550 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 123981 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 240864 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 241289 52291672 ~ 52291920 (-)
G721260 NA non-coding upstream 50840 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 109932 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 110590 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 124871 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 306351 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1274190 51252355 ~ 51259061 (-)
G719151 NA other downstream 1593738 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2643957 49866272 ~ 49937001 (-)
G718489 NA other downstream 2695513 49785674 ~ 49837696 (-)
G716488 NA other downstream 3744247 48788521 ~ 48788962 (-)
G721275 NA other upstream 92593 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 794736 53462034 ~ 53478913 (-)
G722459 NA other upstream 829702 53495804 ~ 53499730 (-)
G722602 NA other upstream 1134997 53803443 ~ 53856065 (-)
G722670 NA other upstream 1257782 53926228 ~ 53927959 (-)

Expression


G721245 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G721245 Expression in each Bioproject

Bar chart with 7 bars.
G721245 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network