G721238



Basic Information


Item Value
gene id G721238
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52589219 ~ 52656589 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU819443
gttctgagagcgataaatgtcccacccagccaaagtcagccacacccttagtattccactcattgggtttctgtagtgtagtggttatcacgttcgcctaacatgcgaaaggtccccggttcgagaccgggcggaaacacattttaacaaattggtccttcgcacttctcagtatttgttattcagactttagtttcagtagtatgttggttatcacgttcgcctcacacgcgaaagtcagtcacacccttagttttccaatcattgggtttctgtagtgtagtggttatcacgttcgcctcacacgcgaaaggtccccggttcgaaaccgggcggaatcattttgtaatattcaatatttcccaatgcccagaggctagcatttggtttgaaacagttgaggtttgtctaaaccttgctgtctacctctccgacctgtggatcaatgt

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU819443 True 449 lncRNA 0.46 4 52589219 52656589
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-81 NA coding downstream 1126 52588021 ~ 52588093 (-)
trnav-aac-80 NA coding downstream 2633 52586514 ~ 52586586 (-)
trnav-aac-79 NA coding downstream 3915 52585232 ~ 52585304 (-)
trnav-uac-13 NA coding downstream 4117 52585030 ~ 52585102 (-)
trnav-aac-78 NA coding downstream 5197 52583950 ~ 52584022 (-)
trnav-aac-129 NA coding upstream 1168 52657757 ~ 52657829 (-)
trnav-cac-40 NA coding upstream 2474 52659063 ~ 52659135 (-)
trnav-aac-130 NA coding upstream 2676 52659265 ~ 52659337 (-)
trnav-cac-41 NA coding upstream 3982 52660571 ~ 52660643 (-)
trnav-aac-131 NA coding upstream 4184 52660773 ~ 52660845 (-)
G721248 NA non-coding downstream 43485 52540080 ~ 52545734 (-)
G721237 NA non-coding downstream 50880 52485609 ~ 52538339 (-)
G721235 NA non-coding downstream 98816 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 129560 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 179991 52408868 ~ 52409228 (-)
G721260 NA non-coding upstream 62697 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 121789 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 122447 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 136728 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 318208 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1330200 51252355 ~ 51259061 (-)
G719151 NA other downstream 1649748 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2699967 49866272 ~ 49937001 (-)
G718489 NA other downstream 2751523 49785674 ~ 49837696 (-)
G716488 NA other downstream 3800257 48788521 ~ 48788962 (-)
G721275 NA other upstream 104450 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 806593 53462034 ~ 53478913 (-)
G722459 NA other upstream 841559 53495804 ~ 53499730 (-)
G722602 NA other upstream 1146854 53803443 ~ 53856065 (-)
G722670 NA other upstream 1269639 53926228 ~ 53927959 (-)

Expression


G721238 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G721238 Expression in each Bioproject

Bar chart with 5 bars.
G721238 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network