G721260



Basic Information


Item Value
gene id G721260
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52719286 ~ 52726784 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU819473
gagccaggcaaattcatttatcagggtcattgtaatggatatatccaaagaaatggcaatataatccaaggtaaaacaaacaaaaatgtagatcgttttctgtcatttcagctgcttgatgtgattgtgtgatatatttagttggctggctagcaaaggaaaagaagctagcctgcataggtacagtgcattcggaaagttttcagaccccttacttttttccacattttgttacgttacagccttattctaaaatggatgaaataaaataaaatctatctacacacaaaacc
>TU819474
gagccaggcaaattcatttatcagggtcattgtaatggatatatccaaagaaatggcaatataatccaaggtaaaacaaacaaaaatgtagatcgttttctgtcatttcagctgcttgatgtgattgtgtgatatatttagttggctggctagcaaaggaaaagaagctagcctgcataggtacagtgcattcggaaagttttcagaccccttacttttttccacattttgttacgttacagccttattctaaaatggatgaaataaaataaaatctatctacacacaaaacc
>TU819472
gagccaggcaaattcatttatcagggtcattgtaatggatatatccaaagaaatggcaatataatccaaggtaaaacaaacaaaaatgtagatcgttttctgtcatttcagctgcttgatgtgattgtgtgatatatttagttggctggctagcaaaggaaaagaagctagcctgcataggtacagtgcattcggaaagttttcagaccccttacttttttccacattttgttacgttacagccttatacta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU819473 False 293 lncRNA 0.35 2 52719286 52726784
TU819474 False 293 lncRNA 0.35 2 52720787 52726784
TU819472 True 252 lncRNA 0.37 2 52724948 52726784
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-150 NA coding downstream 768 52718446 ~ 52718518 (-)
trnav-cac-79 NA coding downstream 970 52718244 ~ 52718316 (-)
trnav-aac-149 NA coding downstream 1941 52717273 ~ 52717345 (-)
trnav-aac-148 NA coding downstream 3114 52716100 ~ 52716172 (-)
trnav-cac-78 NA coding downstream 3316 52715898 ~ 52715970 (-)
trnav-cac-84 NA coding upstream 174 52726958 ~ 52727030 (-)
trnav-cac-85 NA coding upstream 3114 52729898 ~ 52729970 (-)
LOC110530084 LOC106568816 coding upstream 6226 52733010 ~ 52756602 (-)
selenof sep15 coding upstream 66961 52793317 ~ 52818726 (-)
LOC110530090 LOC106568989 coding upstream 179583 52906367 ~ 52917437 (-)
G721245 NA non-coding downstream 50840 52533209 ~ 52668446 (-)
G721238 NA non-coding downstream 62697 52589219 ~ 52656589 (-)
trnav-cac-22 NA non-coding downstream 119150 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 127330 52484057 ~ 52591956 (-)
G721243 NA non-coding downstream 129460 52528403 ~ 52589826 (-)
G721288 NA non-coding upstream 51594 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 52252 52779036 ~ 52779473 (-)
G721414 NA non-coding upstream 248013 52974797 ~ 52977530 (-)
G721425 LOC106568985 non-coding upstream 260133 52986917 ~ 52989556 (-)
LOC110530043 LOC106568739 other downstream 1460267 51252355 ~ 51259061 (-)
G719151 NA other downstream 1779815 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2830034 49866272 ~ 49937001 (-)
G718489 NA other downstream 2881590 49785674 ~ 49837696 (-)
G716488 NA other downstream 3930324 48788521 ~ 48788962 (-)
G721275 NA other upstream 34255 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 736398 53462034 ~ 53478913 (-)
G722459 NA other upstream 771364 53495804 ~ 53499730 (-)
G722602 NA other upstream 1076659 53803443 ~ 53856065 (-)
G722670 NA other upstream 1199444 53926228 ~ 53927959 (-)

Expression


G721260 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G721260 Expression in each Bioproject

Bar chart with 9 bars.
G721260 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network