G721288



Basic Information


Item Value
gene id G721288
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52778378 ~ 52778596 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU819504
gggctatactcagccttgtctcaggatggtaagttggtggttgaagatatccctctagtggtgtgggggctgtgctttggcaaagtgggtggggttatatccttcctgtttggccctgtccgggggtgtcctcggggtgggccacagtgtctcctgacccctcctgtctcagcctccagtatttatgctgcagtagtttatgtgtcggggggctagggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU819504 True 219 lncRNA 0.56 1 52778378 52778596
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530084 LOC106568816 coding downstream 21776 52733010 ~ 52756602 (-)
trnav-cac-85 NA coding downstream 48408 52729898 ~ 52729970 (-)
trnav-cac-84 NA coding downstream 51348 52726958 ~ 52727030 (-)
trnav-cac-83 NA coding downstream 52933 52725373 ~ 52725445 (-)
trnav-aac-152 NA coding downstream 54239 52724067 ~ 52724139 (-)
selenof sep15 coding upstream 15149 52793317 ~ 52818726 (-)
LOC110530090 LOC106568989 coding upstream 127771 52906367 ~ 52917437 (-)
LOC110530094 LOC106568986 coding upstream 170405 52949001 ~ 52967823 (-)
LOC110530097 NA coding upstream 221003 52999599 ~ 53001669 (-)
LOC110530096 LOC106569026 coding upstream 236582 53015178 ~ 53018104 (-)
G721260 NA non-coding downstream 51594 52719286 ~ 52726784 (-)
G721245 NA non-coding downstream 109932 52533209 ~ 52668446 (-)
G721238 NA non-coding downstream 121789 52589219 ~ 52656589 (-)
trnav-cac-22 NA non-coding downstream 178242 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 186422 52484057 ~ 52591956 (-)
G721289 NA non-coding upstream 440 52779036 ~ 52779473 (-)
G721414 NA non-coding upstream 196201 52974797 ~ 52977530 (-)
G721425 LOC106568985 non-coding upstream 208321 52986917 ~ 52989556 (-)
G721435 LOC106568983 non-coding upstream 230093 53008689 ~ 53010120 (-)
G721275 NA other downstream 16927 52761039 ~ 52761451 (-)
LOC110530043 LOC106568739 other downstream 1519359 51252355 ~ 51259061 (-)
G719151 NA other downstream 1838907 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2889126 49866272 ~ 49937001 (-)
G718489 NA other downstream 2940682 49785674 ~ 49837696 (-)
LOC110529122 LOC106568971 other upstream 684586 53462034 ~ 53478913 (-)
G722459 NA other upstream 719552 53495804 ~ 53499730 (-)
G722602 NA other upstream 1024847 53803443 ~ 53856065 (-)
G722670 NA other upstream 1147632 53926228 ~ 53927959 (-)
G722761 NA other upstream 1345783 54124379 ~ 54139341 (-)

Expression


G721288 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G721288 Expression in each Bioproject

Bar chart with 10 bars.
G721288 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network