G721425 (LOC106568985)


Basic Information

Item Value
gene id G721425
gene name LOC106568985
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52986917 ~ 52989556 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU819652
CCTGATGAACTGTATGTTTTGGATGTGGAAAAAGAGTGTATGTACCTACAAGCAGCAGGCGTATAAGAAAAGTGCTGAATGTTCGTAGCCCCAGTCCTACCACTCATTCTCATTTTGAGGCGTTTGACTGGAGTCTCCGTCAGTGTATCACTCCTGGTCTTCAGGTCTTGGAGGTAGGAGGAGAAACTCGAATGCTGATTCATAGGTCTCTTCAGAACCACCGGCACTCCATTTTGACAGCAGTCGTGGCCACACTGATCCTTGTTTTTGCAGAAGTGGTTACATTGTCTTTTGCCTGGAACTCTTTGGTCCAGAGTAGAAGGCACTAAACTTCTGCTGAATGTCCAACCCCACTGCAGAGAGGAAGATCTCAGAGTAGTTAATAGAAGGAGGTGTATATTCTTACTTTTTACAATTATCACTGAAACAATTTAATTAGACTTAAACTGCCTTTTAGAAGTTTTATGTAGTTTGTACAAGTGTATTTTGAACAATGACAAACGTAAAATCCTGACAGTTAACTGCCTGACCGTATTCTGAGCTGATTAGATTCACG

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU819652 True 556 lncRNA 0.42 4 52986917 52989556
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110530094 LOC106568986 coding downstream 19094 52949001 ~ 52967823 (-)
LOC110530090 LOC106568989 coding downstream 69480 52906367 ~ 52917437 (-)
selenof sep15 coding downstream 168210 52793317 ~ 52818726 (-)
LOC110530084 LOC106568816 coding downstream 230315 52733010 ~ 52756602 (-)
trnav-cac-85 NA coding downstream 256947 52729898 ~ 52729970 (-)
LOC110530097 NA coding upstream 10043 52999599 ~ 53001669 (-)
LOC110530096 LOC106569026 coding upstream 25622 53015178 ~ 53018104 (-)
LOC110529119 LOC106569026 coding upstream 29950 53019506 ~ 53022146 (-)
dipk1aa LOC106568980 coding upstream 70090 53059646 ~ 53067786 (-)
LOC110530106 LOC106568974 coding upstream 265641 53255197 ~ 53258515 (-)
G721414 NA non-coding downstream 9387 52974797 ~ 52977530 (-)
G721289 NA non-coding downstream 207444 52779036 ~ 52779473 (-)
G721288 NA non-coding downstream 208321 52778378 ~ 52778596 (-)
G721260 NA non-coding downstream 260133 52719286 ~ 52726784 (-)
G721435 LOC106568983 non-coding upstream 19133 53008689 ~ 53010120 (-)
G721407 NA non-coding upstream 25062 53014618 ~ 53100336 (-)
G721509 NA non-coding upstream 134818 53124374 ~ 53124686 (-)
G721464 LOC106568976 non-coding upstream 159937 53149493 ~ 53152132 (-)
G721515 NA non-coding upstream 163121 53152677 ~ 53152971 (-)
G721275 NA other downstream 225466 52761039 ~ 52761451 (-)
LOC110530043 LOC106568739 other downstream 1727898 51252355 ~ 51259061 (-)
G719151 NA other downstream 2047446 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 3097665 49866272 ~ 49937001 (-)
G718489 NA other downstream 3149221 49785674 ~ 49837696 (-)
LOC110529122 LOC106568971 other upstream 473626 53462034 ~ 53478913 (-)
G722459 NA other upstream 508592 53495804 ~ 53499730 (-)
G722602 NA other upstream 813887 53803443 ~ 53856065 (-)
G722670 NA other upstream 936672 53926228 ~ 53927959 (-)
G722761 NA other upstream 1134823 54124379 ~ 54139341 (-)

Expression

G721425(LOC106568985) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G721425(LOC106568985) Expression in each Bioproject

Bar chart with 15 bars.
G721425(LOC106568985) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network