G722694



Basic Information


Item Value
gene id G722694
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53952195 ~ 53952400 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU821043
ATATTGGAGTGGTTTATTGGGGGTGTGGCTTTCAGTTAGTTTTTATTAGTGAATTCCTGTCAAGTTCATGTGTCATGTTATATTTCATCAATTCTGACTAACGCAGTGCACTGGTTGCTATGAATTCTATCTGATGGTGTTTGCATGTTTAATTGAAAACACATAACGTCCTATTTGGAACATAACTTCTCTATTTTATTGGGTGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU821043 True 206 lncRNA 0.35 1 53952195 53952400
Loading

Neighbor


gene id symbol gene type direction distance location
insl3 NA coding downstream 34578 53914820 ~ 53917617 (-)
LOC110530934 LOC106568959 coding downstream 71410 53818706 ~ 53880785 (-)
ocel1 LOC106568960 coding downstream 140003 53806663 ~ 53812192 (-)
plvapa LOC106568963 coding downstream 223524 53722172 ~ 53728671 (-)
trnak-cuu-2 NA coding downstream 255495 53696628 ~ 53696700 (-)
LOC110530121 LOC106568956 coding upstream 13597 53965997 ~ 53995304 (-)
LOC110530123 rps15 coding upstream 48729 54001129 ~ 54003188 (-)
LOC118965682 NA coding upstream 50034 54002434 ~ 54002567 (-)
cnn2 cnn2 coding upstream 56034 54008434 ~ 54014434 (-)
crsp7 LOC106568954 coding upstream 72336 54024736 ~ 54039572 (-)
G722686 NA non-coding downstream 7249 53944594 ~ 53944946 (-)
G722659 NA non-coding downstream 46733 53905148 ~ 53905462 (-)
G722612 NA non-coding downstream 123136 53828679 ~ 53829059 (-)
LOC110530114 LOC106568966 non-coding downstream 242828 53635788 ~ 53709367 (-)
G722696 NA non-coding upstream 1797 53954197 ~ 53954429 (-)
G722699 NA non-coding upstream 12776 53965176 ~ 53965407 (-)
G722728 NA non-coding upstream 80891 54033291 ~ 54034722 (-)
G722805 LOC106568951 non-coding upstream 228042 54180442 ~ 54185532 (-)
G722812 NA non-coding upstream 235669 54188069 ~ 54189214 (-)
G722670 NA other downstream 24236 53926228 ~ 53927959 (-)
G722602 NA other downstream 96130 53803443 ~ 53856065 (-)
G722459 NA other downstream 452465 53495804 ~ 53499730 (-)
LOC110529122 LOC106568971 other downstream 488431 53462034 ~ 53478913 (-)
G721275 NA other downstream 1190744 52761039 ~ 52761451 (-)
G722761 NA other upstream 171979 54124379 ~ 54139341 (-)
G722854 NA other upstream 298714 54251114 ~ 54251546 (-)
G722864 LOC106581475 other upstream 329285 54281685 ~ 54281978 (-)
G723955 NA other upstream 1424881 55377281 ~ 55377776 (-)
G723966 NA other upstream 1444224 55396624 ~ 55396885 (-)

Expression


G722694 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G722694 Expression in each Bioproject

Bar chart with 9 bars.
G722694 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network