G722761


Basic Information

Item Value
gene id G722761
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54124379 ~ 54139341 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU821119
agaaaacgtttgacaaggttttcacacactgttgctggtattttggcccattcctccatgcagatctcctctagagcagtgatgtattggggctgttgctgggcaacacagactttcaactccctccaaagattttctatggggttgagatctggagactggctaggccactccaggaccttgaaatgcttcttacgaagccactccttcgttgcccgggcggtgtgtttgggatcattgtcatgctgaaagacccagccacgtttcatcttcaatgcccttgctgatggaaggaggttcactcaaaatctcacgatacatggccccattcattctttcctttacacggatcagtcgtcctggtccctttgcagaaaaacagccccaaagcatgatgtttccacccccatgcttcacagtaggtatggtgttctttggatgcaactcagcattctttgtcctccaaacacgacgagttttaccaaaaagttatattttggtttcatctgaccatatgacattctcccaatcttcttctggatcatccaaatgctctctagcaaacttcagatgggcctggacatgtctggcactgcaggatttgaggccctagcggcgtagtgtgttgtactgatggtaggctttgttactttggttccagctctctgcaggtcattcactaggtccccccgtgtggttctgggatttttgctcaccgttcttgtgatcattttgaccccacggggtgagatcttgcgtggagccccagatcgagggagattatcagtggtcttgtatgtcttccatttcctaataattgctcccacagttgatttcttcaaaccaaggtgacca

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU821119 True 855 TUCP 0.48 2 54124379 54139341
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110530125 LOC106568953 coding downstream 18969 54058122 ~ 54105410 (-)
crsp7 LOC106568954 coding downstream 84807 54024736 ~ 54039572 (-)
cnn2 cnn2 coding downstream 109945 54008434 ~ 54014434 (-)
LOC110530123 rps15 coding downstream 121191 54001129 ~ 54003188 (-)
LOC118965682 NA coding downstream 121812 54002434 ~ 54002567 (-)
LOC110530134 LOC106568945 coding upstream 234892 54374233 ~ 54377574 (-)
LOC110530139 LOC100194659 coding upstream 303789 54443130 ~ 54445222 (-)
LOC110530140 LOC106568942 coding upstream 306878 54446219 ~ 54465716 (-)
LOC110530141 LOC106568941 coding upstream 338584 54477925 ~ 54485773 (-)
LOC110530142 LOC106568939 coding upstream 359022 54498363 ~ 54507488 (-)
G722728 NA non-coding downstream 89657 54033291 ~ 54034722 (-)
G722699 NA non-coding downstream 158972 53965176 ~ 53965407 (-)
G722696 NA non-coding downstream 169950 53954197 ~ 53954429 (-)
G722694 NA non-coding downstream 171979 53952195 ~ 53952400 (-)
G722686 NA non-coding downstream 179433 53944594 ~ 53944946 (-)
G722805 LOC106568951 non-coding upstream 41101 54180442 ~ 54185532 (-)
G722812 NA non-coding upstream 48728 54188069 ~ 54189214 (-)
G722814 NA non-coding upstream 50051 54189392 ~ 54243058 (-)
G722773 LOC106568951 non-coding upstream 65347 54204688 ~ 54207815 (-)
G722849 NA non-coding upstream 107731 54247072 ~ 54247859 (-)
G722670 NA other downstream 196420 53926228 ~ 53927959 (-)
G722602 NA other downstream 268314 53803443 ~ 53856065 (-)
G722459 NA other downstream 624649 53495804 ~ 53499730 (-)
LOC110529122 LOC106568971 other downstream 660615 53462034 ~ 53478913 (-)
G721275 NA other downstream 1362928 52761039 ~ 52761451 (-)
G722854 NA other upstream 111773 54251114 ~ 54251546 (-)
G722864 LOC106581475 other upstream 142344 54281685 ~ 54281978 (-)
G723955 NA other upstream 1237940 55377281 ~ 55377776 (-)
G723966 NA other upstream 1257283 55396624 ~ 55396885 (-)
G724287 LOC106568908 other upstream 1496197 55635538 ~ 55646014 (-)

Expression

G722761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G722761 Expression in each Bioproject

Bar chart with 21 bars.
G722761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network