G722814



Basic Information


Item Value
gene id G722814
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54189392 ~ 54243058 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU821176
GGGCAAGCGCATGCAGGAACCCTCATCTCTGGAATCCTCGAGATGACTACATGTCGAGATGAGGACTACAAAAACAGGGACAAGTGGCTCAAATGCCTGCACAGGCTGAGCACAGAGGTGCCCTTCTCAGGAGATGACTCTCACCATTGACCACCTGTCCGAAGAGCTGTTCGGGTGTGTCTCCGAAGAAAGGTACGCAGCCCACCAGGAACTCATAGAGGATGATGCCCATAGCCCACCAGTCCACCGGCTTCCCATAGCCTTGCCTCAGGATCACCTCTGGAGCAATGTACTCCGGTGTACCACACA

Function


NR:

description
microtubule-associated serine/threonine-protein kinase 3-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU821176 True 309 lncRNA 0.55 3 54189392 54243058
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530126 LOC106569003 coding downstream 57653 54127068 ~ 54131739 (-)
LOC110530125 LOC106568953 coding downstream 83982 54058122 ~ 54105410 (-)
crsp7 LOC106568954 coding downstream 149820 54024736 ~ 54039572 (-)
cnn2 cnn2 coding downstream 174958 54008434 ~ 54014434 (-)
LOC118965682 NA coding downstream 186825 54002434 ~ 54002567 (-)
LOC110530134 LOC106568945 coding upstream 131175 54374233 ~ 54377574 (-)
LOC110530139 LOC100194659 coding upstream 200072 54443130 ~ 54445222 (-)
LOC110530140 LOC106568942 coding upstream 203161 54446219 ~ 54465716 (-)
LOC110530141 LOC106568941 coding upstream 234867 54477925 ~ 54485773 (-)
LOC110530142 LOC106568939 coding upstream 255305 54498363 ~ 54507488 (-)
G722812 NA non-coding downstream 178 54188069 ~ 54189214 (-)
G722805 LOC106568951 non-coding downstream 3860 54180442 ~ 54185532 (-)
G722728 NA non-coding downstream 154670 54033291 ~ 54034722 (-)
G722699 NA non-coding downstream 223985 53965176 ~ 53965407 (-)
G722696 NA non-coding downstream 234963 53954197 ~ 53954429 (-)
G722849 NA non-coding upstream 4014 54247072 ~ 54247859 (-)
G722853 NA non-coding upstream 9087 54252145 ~ 54252842 (-)
G722852 NA non-coding upstream 11104 54254162 ~ 54254404 (-)
G722860 NA non-coding upstream 20681 54263739 ~ 54263859 (-)
G722863 NA non-coding upstream 29718 54272776 ~ 54273055 (-)
G722761 NA other downstream 50051 54124379 ~ 54139341 (-)
G722670 NA other downstream 261433 53926228 ~ 53927959 (-)
G722602 NA other downstream 333327 53803443 ~ 53856065 (-)
G722459 NA other downstream 689662 53495804 ~ 53499730 (-)
LOC110529122 LOC106568971 other downstream 725628 53462034 ~ 53478913 (-)
G722854 NA other upstream 8056 54251114 ~ 54251546 (-)
G722864 LOC106581475 other upstream 38627 54281685 ~ 54281978 (-)
G723955 NA other upstream 1134223 55377281 ~ 55377776 (-)
G723966 NA other upstream 1153566 55396624 ~ 55396885 (-)
G724287 LOC106568908 other upstream 1392480 55635538 ~ 55646014 (-)

Expression


G722814 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G722814 Expression in each Bioproject

Bar chart with 8 bars.
G722814 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network