G722854



Basic Information


Item Value
gene id G722854
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54251114 ~ 54251546 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU821220
gattaaaccaaaattgaactttttggcaacaatgcaaaacattatgtttggcgtaaaagcaacacagcttaacacaccatccccactgtcaaacatggtggcggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagcaaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacttgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctgcaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU821220 True 433 TUCP 0.42 1 54251114 54251546

Neighbor


gene id symbol gene type direction distance location
LOC110530126 LOC106569003 coding downstream 119375 54127068 ~ 54131739 (-)
LOC110530125 LOC106568953 coding downstream 145704 54058122 ~ 54105410 (-)
crsp7 LOC106568954 coding downstream 211542 54024736 ~ 54039572 (-)
cnn2 cnn2 coding downstream 236680 54008434 ~ 54014434 (-)
LOC110530123 rps15 coding downstream 247926 54001129 ~ 54003188 (-)
LOC110530134 LOC106568945 coding upstream 122687 54374233 ~ 54377574 (-)
LOC110530139 LOC100194659 coding upstream 191584 54443130 ~ 54445222 (-)
LOC110530140 LOC106568942 coding upstream 194673 54446219 ~ 54465716 (-)
LOC110530141 LOC106568941 coding upstream 226379 54477925 ~ 54485773 (-)
LOC110530142 LOC106568939 coding upstream 246817 54498363 ~ 54507488 (-)
G722849 NA non-coding downstream 3255 54247072 ~ 54247859 (-)
G722814 NA non-coding downstream 8056 54189392 ~ 54243058 (-)
G722773 LOC106568951 non-coding downstream 43299 54204688 ~ 54207815 (-)
G722812 NA non-coding downstream 61900 54188069 ~ 54189214 (-)
G722805 LOC106568951 non-coding downstream 65582 54180442 ~ 54185532 (-)
G722853 NA non-coding upstream 599 54252145 ~ 54252842 (-)
G722852 NA non-coding upstream 2616 54254162 ~ 54254404 (-)
G722860 NA non-coding upstream 12193 54263739 ~ 54263859 (-)
G722863 NA non-coding upstream 21230 54272776 ~ 54273055 (-)
G722862 NA non-coding upstream 25223 54276769 ~ 54277039 (-)
G722761 NA other downstream 111773 54124379 ~ 54139341 (-)
G722670 NA other downstream 323155 53926228 ~ 53927959 (-)
G722602 NA other downstream 395049 53803443 ~ 53856065 (-)
G722459 NA other downstream 751384 53495804 ~ 53499730 (-)
LOC110529122 LOC106568971 other downstream 787350 53462034 ~ 53478913 (-)
G722864 LOC106581475 other upstream 30139 54281685 ~ 54281978 (-)
G723955 NA other upstream 1125735 55377281 ~ 55377776 (-)
G723966 NA other upstream 1145078 55396624 ~ 55396885 (-)
G724287 LOC106568908 other upstream 1383992 55635538 ~ 55646014 (-)
G724400 NA other upstream 1533971 55785517 ~ 55791485 (-)

Expression


G722854 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G722854 Expression in each Bioproject

Bar chart with 20 bars.
G722854 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network