G722864 (LOC106581475)



Basic Information


Item Value
gene id G722864
gene name LOC106581475
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54281685 ~ 54281978 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU821231
ccaggatggaacatcaatgcgagctgtggcaaggtttgctgtgtctgtcagcgtagtgtccagagcatggaggcgctaccaggagaaaggccagtacatcaggagacgtggaggaggccgtaggagggcaacaacccagcagcaggaccgctacctccgcctttgtgcaaggaggagcaggaggagcactgccagagccctgcaaaatgacctccagcaggccacaaatgtgcatgtgtctgctcaaacggtcagatacagactccatgagggtggtatgagggcccgacgtcc

Function


NR:

description
PREDICTED: uncharacterized protein LOC109523355 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU821231 True 294 TUCP 0.58 1 54281685 54281978
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530126 LOC106569003 coding downstream 149946 54127068 ~ 54131739 (-)
LOC110530125 LOC106568953 coding downstream 176275 54058122 ~ 54105410 (-)
crsp7 LOC106568954 coding downstream 242113 54024736 ~ 54039572 (-)
cnn2 cnn2 coding downstream 267251 54008434 ~ 54014434 (-)
LOC118965682 NA coding downstream 279118 54002434 ~ 54002567 (-)
LOC110530134 LOC106568945 coding upstream 92255 54374233 ~ 54377574 (-)
LOC110530139 LOC100194659 coding upstream 161152 54443130 ~ 54445222 (-)
LOC110530140 LOC106568942 coding upstream 164241 54446219 ~ 54465716 (-)
LOC110530141 LOC106568941 coding upstream 195947 54477925 ~ 54485773 (-)
LOC110530142 LOC106568939 coding upstream 216385 54498363 ~ 54507488 (-)
G722862 NA non-coding downstream 4646 54276769 ~ 54277039 (-)
G722863 NA non-coding downstream 8630 54272776 ~ 54273055 (-)
G722860 NA non-coding downstream 17826 54263739 ~ 54263859 (-)
G722852 NA non-coding downstream 27281 54254162 ~ 54254404 (-)
G722853 NA non-coding downstream 28843 54252145 ~ 54252842 (-)
G722906 NA non-coding upstream 48787 54330765 ~ 54331775 (-)
G722949 NA non-coding upstream 122637 54404615 ~ 54405913 (-)
G722978 NA non-coding upstream 186927 54468905 ~ 54469431 (-)
G722990 NA non-coding upstream 228185 54510163 ~ 54510508 (-)
G722993 NA non-coding upstream 231367 54513345 ~ 54514044 (-)
G722854 NA other downstream 30139 54251114 ~ 54251546 (-)
G722761 NA other downstream 142344 54124379 ~ 54139341 (-)
G722670 NA other downstream 353726 53926228 ~ 53927959 (-)
G722602 NA other downstream 425620 53803443 ~ 53856065 (-)
G722459 NA other downstream 781955 53495804 ~ 53499730 (-)
G723955 NA other upstream 1095303 55377281 ~ 55377776 (-)
G723966 NA other upstream 1114646 55396624 ~ 55396885 (-)
G724287 LOC106568908 other upstream 1353560 55635538 ~ 55646014 (-)
G724400 NA other upstream 1503539 55785517 ~ 55791485 (-)
G724943 LOC106604981 other upstream 1838225 56120203 ~ 56128288 (-)

Expression


G722864(LOC106581475) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G722864(LOC106581475) Expression in each Bioproject

Bar chart with 20 bars.
G722864(LOC106581475) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network