G723966



Basic Information


Item Value
gene id G723966
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55396624 ~ 55396885 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU822429
tctgggacactgtgaagtccatggagaacaagagcacctcctcccagctgcccactgcactgaggctaggtaacacggtcaccaccgataaatccatgattatcgaaaacttcaacaagcatttctcaatggctggccatgccttccgcctggctactccaacctcggccaacagctccgcccccccccgcagctactcgcccaagcctctccaggttctcctttacccaaatccagatagcagatgttctgaaagagctgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU822429 True 262 TUCP 0.55 1 55396624 55396885

Neighbor


gene id symbol gene type direction distance location
LOC110530163 LOC106568918 coding downstream 59026 55335612 ~ 55337598 (-)
LOC110530161 LOC106568919 coding downstream 83020 55304680 ~ 55313604 (-)
LOC110530159 LOC106569020 coding downstream 173296 55217971 ~ 55223328 (-)
LOC118965529 NA coding downstream 181891 55211750 ~ 55214733 (-)
LOC110530157 LOC106568924 coding downstream 185521 55203683 ~ 55211103 (-)
si:ch211-106h4.4 LOC106568915 coding upstream 26781 55423666 ~ 55456052 (-)
LOC110530166 arpc5 coding upstream 64311 55461196 ~ 55468070 (-)
odr4 odr4 coding upstream 136731 55533616 ~ 55544134 (-)
LOC118965626 NA coding upstream 158993 55555878 ~ 55564099 (-)
LOC110530170 LOC106568909 coding upstream 170958 55567843 ~ 55614934 (-)
G723956 NA non-coding downstream 18285 55378090 ~ 55378339 (-)
G723891 NA non-coding downstream 122721 55257662 ~ 55273903 (-)
G723844 NA non-coding downstream 209744 55186561 ~ 55186880 (-)
G723843 LOC106569022 non-coding downstream 210497 55185627 ~ 55186127 (-)
G723967 NA non-coding upstream 2164 55399049 ~ 55399513 (-)
G723969 NA non-coding upstream 5727 55402612 ~ 55403050 (-)
G723970 NA non-coding upstream 7659 55404544 ~ 55404942 (-)
G723971 LOC106568916 non-coding upstream 8422 55405307 ~ 55405879 (-)
G723979 NA non-coding upstream 26169 55423054 ~ 55470008 (-)
G723955 NA other downstream 18848 55377281 ~ 55377776 (-)
G722864 LOC106581475 other downstream 1114646 54281685 ~ 54281978 (-)
G722854 NA other downstream 1145078 54251114 ~ 54251546 (-)
G722761 NA other downstream 1257283 54124379 ~ 54139341 (-)
G722670 NA other downstream 1468665 53926228 ~ 53927959 (-)
G724287 LOC106568908 other upstream 238653 55635538 ~ 55646014 (-)
G724400 NA other upstream 388632 55785517 ~ 55791485 (-)
G724943 LOC106604981 other upstream 723318 56120203 ~ 56128288 (-)
G725007 LOC106568897 other upstream 822631 56219516 ~ 56232939 (-)
LOC110530186 tm56b other upstream 977768 56374588 ~ 56386555 (-)

Expression


G723966 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G723966 Expression in each Bioproject

Bar chart with 20 bars.
G723966 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network