G723970



Basic Information


Item Value
gene id G723970
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55404544 ~ 55404942 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU822433
gacatacacaaaatagtccaaattggtgaagtgaaatgaaaaaatgttactaaaaaacggaaaagtggtgcgtgcatatgtattcaccccctttgctgtgaatcccctaaataagatctggtgcaaccaattaccttcagaagtcacataattagttaaataaagtccacctgtgtgcaatctaagtgtcacatgatctgtcacatgtctcagtatatatacacctgttctgaaaggccccagagtctgcaacaccactaagcaaggggcaccaccaagcaagcggcaccatgaagaccaaggagctctccaaacaggccagggacaaagttgtggagaagtacagatcagggttgagttataaaaaaaatatccaaaactttgaacaccccacagagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU822433 True 399 lncRNA 0.42 1 55404544 55404942

Neighbor


gene id symbol gene type direction distance location
LOC110530163 LOC106568918 coding downstream 66946 55335612 ~ 55337598 (-)
LOC110530161 LOC106568919 coding downstream 90940 55304680 ~ 55313604 (-)
LOC110530159 LOC106569020 coding downstream 181216 55217971 ~ 55223328 (-)
LOC118965529 NA coding downstream 189811 55211750 ~ 55214733 (-)
LOC110530157 LOC106568924 coding downstream 193441 55203683 ~ 55211103 (-)
si:ch211-106h4.4 LOC106568915 coding upstream 18724 55423666 ~ 55456052 (-)
LOC110530166 arpc5 coding upstream 56254 55461196 ~ 55468070 (-)
odr4 odr4 coding upstream 128674 55533616 ~ 55544134 (-)
LOC118965626 NA coding upstream 150936 55555878 ~ 55564099 (-)
LOC110530170 LOC106568909 coding upstream 162901 55567843 ~ 55614934 (-)
G723969 NA non-coding downstream 1494 55402612 ~ 55403050 (-)
G723967 NA non-coding downstream 5031 55399049 ~ 55399513 (-)
G723956 NA non-coding downstream 26205 55378090 ~ 55378339 (-)
G723891 NA non-coding downstream 130641 55257662 ~ 55273903 (-)
G723971 LOC106568916 non-coding upstream 365 55405307 ~ 55405879 (-)
G723979 NA non-coding upstream 18112 55423054 ~ 55470008 (-)
G724020 NA non-coding upstream 94524 55499466 ~ 55499860 (-)
G724042 NA non-coding upstream 105396 55510338 ~ 55510564 (-)
G724245 NA non-coding upstream 140792 55545734 ~ 55545995 (-)
G723966 NA other downstream 7659 55396624 ~ 55396885 (-)
G723955 NA other downstream 26768 55377281 ~ 55377776 (-)
G722864 LOC106581475 other downstream 1122566 54281685 ~ 54281978 (-)
G722854 NA other downstream 1152998 54251114 ~ 54251546 (-)
G722761 NA other downstream 1265203 54124379 ~ 54139341 (-)
G724287 LOC106568908 other upstream 230596 55635538 ~ 55646014 (-)
G724400 NA other upstream 380575 55785517 ~ 55791485 (-)
G724943 LOC106604981 other upstream 715261 56120203 ~ 56128288 (-)
G725007 LOC106568897 other upstream 814574 56219516 ~ 56232939 (-)
LOC110530186 tm56b other upstream 969711 56374588 ~ 56386555 (-)

Expression


G723970 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G723970 Expression in each Bioproject

Bar chart with 20 bars.
G723970 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network