G724264



Basic Information


Item Value
gene id G724264
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55575059 ~ 55575687 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU822754
tctctctctctctgtgtctctctctctgtgtctctctctctctgtgtctctctctctctgtgtctctcactctctgtgtctctcgctctttgtgtctctctctctctgtgtgtctctctctgtgtctctctctctctgtgtgtctctctctctctgtgtgtctctctctgtgtctctctctctctgtgtgtgtctctctctctgtgtctctctctctct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU822754 True 219 lncRNA 0.50 2 55575059 55575687

Neighbor


gene id symbol gene type direction distance location
LOC118965626 NA coding downstream 10960 55555878 ~ 55564099 (-)
odr4 odr4 coding downstream 30925 55533616 ~ 55544134 (-)
LOC110530166 arpc5 coding downstream 106989 55461196 ~ 55468070 (-)
si:ch211-106h4.4 LOC106568915 coding downstream 119007 55423666 ~ 55456052 (-)
LOC110530163 LOC106568918 coding downstream 237461 55335612 ~ 55337598 (-)
LOC110530171 LOC106568907 coding upstream 107938 55683625 ~ 55688984 (-)
LOC110530174 LOC106568905 coding upstream 154747 55730434 ~ 55764053 (-)
LOC110530175 LOC106569017 coding upstream 193739 55769426 ~ 55774173 (-)
LOC110530176 LOC106568901 coding upstream 224221 55799908 ~ 55814928 (-)
LOC110530178 LOC106568902 coding upstream 239697 55815384 ~ 55839341 (-)
G724246 NA non-coding downstream 27942 55546847 ~ 55547117 (-)
G724245 NA non-coding downstream 29064 55545734 ~ 55545995 (-)
G724042 NA non-coding downstream 64495 55510338 ~ 55510564 (-)
G724020 NA non-coding downstream 75199 55499466 ~ 55499860 (-)
G723979 NA non-coding downstream 105051 55423054 ~ 55470008 (-)
G724272 NA non-coding upstream 12801 55588488 ~ 55589616 (-)
G724366 LOC106568906 non-coding upstream 142177 55717864 ~ 55718713 (-)
G724370 NA non-coding upstream 145397 55721084 ~ 55721324 (-)
G724371 NA non-coding upstream 146416 55722103 ~ 55722418 (-)
G724372 NA non-coding upstream 147290 55722977 ~ 55723486 (-)
G723966 NA other downstream 178174 55396624 ~ 55396885 (-)
G723955 NA other downstream 197283 55377281 ~ 55377776 (-)
G722864 LOC106581475 other downstream 1293081 54281685 ~ 54281978 (-)
G722854 NA other downstream 1323513 54251114 ~ 54251546 (-)
G722761 NA other downstream 1435718 54124379 ~ 54139341 (-)
G724287 LOC106568908 other upstream 59851 55635538 ~ 55646014 (-)
G724400 NA other upstream 209830 55785517 ~ 55791485 (-)
G724943 LOC106604981 other upstream 544516 56120203 ~ 56128288 (-)
G725007 LOC106568897 other upstream 643829 56219516 ~ 56232939 (-)
LOC110530186 tm56b other upstream 798966 56374588 ~ 56386555 (-)

Expression


G724264 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G724264 Expression in each Bioproject

Bar chart with 13 bars.
G724264 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network