G725912



Basic Information


Item Value
gene id G725912
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 57584259 ~ 57584527 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU824660
ccatccaacctcactgagctcgagctgttttgcaaggaagaatgggggaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcactcccagtttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU824660 True 269 lncRNA 0.41 1 57584259 57584527
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530216 LOC106568865 coding upstream 2066 57572651 ~ 57582193 (+)
LOC110530217 LOC106568867 coding upstream 11883 57558028 ~ 57572376 (+)
LOC110530213 LOC106568871 coding upstream 105404 57421244 ~ 57478855 (+)
car8 car8 coding upstream 222446 57339585 ~ 57361813 (+)
asph LOC106568874 coding upstream 453747 57108203 ~ 57130512 (+)
eif4g1a NA coding downstream 13308 57597835 ~ 57625254 (+)
LOC118965660 NA coding downstream 38186 57622713 ~ 57622840 (+)
LOC118965680 NA coding downstream 38744 57623271 ~ 57623401 (+)
fam131a LOC106568863 coding downstream 47855 57632382 ~ 57641650 (+)
LOC110530222 LOC106568862 coding downstream 112487 57697014 ~ 57700551 (+)
G725906 LOC106590568 non-coding upstream 31115 57552838 ~ 57553144 (+)
G725905 NA non-coding upstream 34241 57549790 ~ 57550018 (+)
G725895 NA non-coding upstream 44711 57539293 ~ 57539548 (+)
G725892 NA non-coding upstream 47795 57536238 ~ 57536464 (+)
G725949 NA non-coding downstream 93324 57677851 ~ 57678662 (+)
G725969 NA non-coding downstream 138317 57722844 ~ 57723061 (+)
LOC110530223 per2 non-coding downstream 182299 57766651 ~ 57798129 (+)
G726031 NA non-coding downstream 246862 57831389 ~ 57836550 (+)
G725907 LOC106581475 other upstream 28777 57554723 ~ 57555482 (+)
G725878 NA other upstream 68865 57513606 ~ 57515394 (+)
G725573 NA other upstream 599974 56983570 ~ 56984285 (+)
si:ch211-267e7.3 LOC106568906 other upstream 1866022 55710156 ~ 55724271 (+)
LOC118965533 NA other downstream 268485 57850799 ~ 57854417 (+)
G727161 NA other downstream 772512 58357039 ~ 58358245 (+)
G727348 NA other downstream 1062332 58646859 ~ 58674005 (+)
G728057 LOC100136012 other downstream 1396404 58980931 ~ 58981271 (+)
LOC110530248 crem other downstream 2175948 59748668 ~ 59768093 (+)

Expression


G725912 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G725912 Expression in each Bioproject

Bar chart with 20 bars.
G725912 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network