G729274



Basic Information


Item Value
gene id G729274
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 60122190 ~ 60122743 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU828330
ctgcttggctgagaaatcgaccgaaaaatacttcaactataacgccaaacttttttcaaaatttgctccataatatcgacagaaacacggcaaacgttgtttaggatccatcctcaaggtgtttttaacatatgtattcgataatatatccgtcgaggcagttggtttctcataagaagcgattggaaaaatggctacctcagtattttacgcaaggttttctgcgggagacaccatgtgaccacattccatatatggtcccttacagccattcttcaagggaaatgcctaaaaagacgtcacaatgctgtagacaccttggggaaaacgtggaaaacgtaagctcattcgtagctcattcacagccatataaggagtcattggcatgaggcggtttcaaaaaatgcggcacttcctgattggatttttatctgggtttcgcctgtaacatcagttctgtggcactcacagacaatatctttgtagttttggaaacgtcagagtgttttctttccaaagctgtcaattatatgcatagtcaagcatcttttcgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU828330 True 554 lncRNA 0.41 1 60122190 60122743

Neighbor


gene id symbol gene type direction distance location
LOC110530253 LOC106568832 coding upstream 44691 60072133 ~ 60077499 (+)
LOC110530251 LOC106568834 coding upstream 293778 59825297 ~ 59828412 (+)
LOC110530249 LOC106568835 coding upstream 297126 59775730 ~ 59825064 (+)
LOC110530248 crem coding upstream 354097 59748668 ~ 59768093 (+)
LOC110530237 LOC106568845 coding upstream 910373 59188067 ~ 59211817 (+)
LOC110530254 LOC106568831 coding downstream 33599 60156342 ~ 60168950 (+)
LOC110530256 LOC106568829 coding downstream 109568 60232311 ~ 60268663 (+)
LOC110530260 LOC106568826 coding downstream 198215 60320958 ~ 60346708 (+)
LOC110530261 LOC106568825 coding downstream 231195 60353938 ~ 60597494 (+)
LOC110530263 LOC106568823 coding downstream 512361 60635104 ~ 60677201 (+)
G729265 NA non-coding upstream 12315 60109644 ~ 60109875 (+)
G729263 NA non-coding upstream 14290 60107699 ~ 60107900 (+)
G729247 NA non-coding upstream 30365 60091364 ~ 60091825 (+)
G729231 NA non-coding upstream 56601 60065273 ~ 60065589 (+)
G729168 NA non-coding upstream 154619 59967354 ~ 59967571 (+)
G729278 NA non-coding downstream 4017 60126760 ~ 60126998 (+)
G729172 NA non-coding downstream 15994 60138737 ~ 60170075 (+)
G729306 LOC106568830 non-coding downstream 62693 60185436 ~ 60253409 (+)
G729359 NA non-coding downstream 146023 60268766 ~ 60269047 (+)
G729360 LOC106562215 non-coding downstream 149198 60271941 ~ 60273016 (+)
G728057 LOC100136012 other upstream 1140919 58980931 ~ 58981271 (+)
G727348 NA other upstream 1448185 58646859 ~ 58674005 (+)
G727161 NA other upstream 1764055 58357039 ~ 58358245 (+)
LOC118965533 NA other upstream 2268558 57850799 ~ 57854417 (+)
G730206 NA other downstream 917825 61040568 ~ 61042129 (+)
G730267 NA other downstream 1036067 61158810 ~ 61159193 (+)
G730377 NA other downstream 1247284 61370027 ~ 61810354 (+)
G730425 NA other downstream 1307120 61429863 ~ 61468746 (+)
G730447 NA other downstream 1344610 61467353 ~ 61468047 (+)

Expression


G729274 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G729274 Expression in each Bioproject

Bar chart with 21 bars.
G729274 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network