G736858



Basic Information


Item Value
gene id G736858
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 66119950 ~ 66120476 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU836741
gttgagacgggtgttttgcgggtattatttaatgaagctgccagttgaggacttgtgaggtgtctgtttctcaaactagatactctaatgtacttgtcctcttgttcagttgtgcaccggggcctcccactctttctattctggttagaggcagtttgcgctgttctgtgaagggagtagttcacagcgttgtaccagatcttcagtttcttggcaatttctcgcatggtatagcgttaatttctcagaacaagaatagactgacgagtttcagaagaaaggtctttgtttctgaccattttgagcctgtaatcgaacccacaaatgctgatgctccagtctaatgaaggccagttttattacttctttaaatcagaacaacagttttcagctgtgctaacataattgtaaacgggttttctaatgatcaattagccttttaaaatgataaacttggattagctaacactacgtgccattggaacacaggagtgatggttgctgataatgggcctctgtagatattc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU836741 True 527 lncRNA 0.41 1 66119950 66120476
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530374 NA coding downstream 22999 66076814 ~ 66096951 (-)
LOC110529131 LOC106569222 coding downstream 224900 65893819 ~ 65895050 (-)
LOC110530368 LOC106569223 coding downstream 237571 65738261 ~ 65882379 (-)
LOC110529129 LOC106569288 coding downstream 427175 65691486 ~ 65692775 (-)
LOC110530362 LOC106569229 coding downstream 481963 65608778 ~ 65637987 (-)
LOC110530385 LOC106569212 coding upstream 71883 66192359 ~ 66210028 (-)
LOC110530388 LOC106569209 coding upstream 153312 66273788 ~ 66332261 (-)
LOC110530389 LOC106569208 coding upstream 217794 66338270 ~ 66381730 (-)
LOC110530391 LOC106569207 coding upstream 269728 66390204 ~ 66433725 (-)
LOC118965631 NA coding upstream 489827 66610303 ~ 66618598 (-)
G736856 NA non-coding downstream 1976 66117772 ~ 66117974 (-)
G736840 NA non-coding downstream 20020 66099728 ~ 66099930 (-)
G736833 NA non-coding downstream 43397 66075644 ~ 66076553 (-)
G736831 NA non-coding downstream 54553 66064989 ~ 66065397 (-)
G736827 NA non-coding downstream 59057 66060650 ~ 66060893 (-)
G736893 NA non-coding upstream 48006 66168482 ~ 66169062 (-)
G736888 NA non-coding upstream 77752 66198228 ~ 66199927 (-)
G736915 NA non-coding upstream 86945 66207421 ~ 66207711 (-)
G736918 NA non-coding upstream 98931 66219407 ~ 66219822 (-)
G736841 LOC106569214 other downstream 18323 66101096 ~ 66101627 (-)
G736216 NA other downstream 591367 65518167 ~ 65528583 (-)
G735880 NA other downstream 1079709 64990301 ~ 65040241 (-)
LOC110530961 dhx9 other downstream 3934770 62165849 ~ 62185180 (-)
G731764 NA other downstream 4071831 62045035 ~ 62048119 (-)
G737449 LOC106569204 other upstream 438720 66559196 ~ 66560517 (-)
G737422 LOC106569284 other upstream 593217 66713693 ~ 66714496 (-)
G738472 LOC106569192 other upstream 1260744 67381220 ~ 67381977 (-)
G738502 LOC106569192 other upstream 1300263 67420739 ~ 67421056 (-)

Expression


G736858 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G736858 Expression in each Bioproject

Bar chart with 19 bars.
G736858 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network