G736625


Basic Information

Item Value
gene id G736625
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 66219365 ~ 66219569 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU836463
atcaaatcaaatgttatttgtcacatacacctggttagccgatgttaatgggagtgtagcgaaatgcttgtgcttctagttacgaccatgcagtaatatctaacaagtaatctaaccttacaatttcacaacaactatattatacacacaagtgtaaaggaatgaatatgaatatgtacataaaaatatatgaatgagtgatggc

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU836463 True 205 lncRNA 0.33 1 66219365 66219569

Neighbor

gene id symbol gene type direction distance location
blvra blvra coding upstream 521 66210003 ~ 66218844 (+)
LOC110530963 LOC106569213 coding upstream 19739 66131102 ~ 66199626 (+)
LOC110530386 NA coding upstream 77909 66139734 ~ 66141456 (+)
LOC110530382 ccr3 coding upstream 90864 66126013 ~ 66128501 (+)
si:ch211-106n13.3 LOC106569214 coding upstream 93433 66100360 ~ 66125932 (+)
LOC110530387 LOC106569210 coding downstream 4413 66223982 ~ 66260619 (+)
LOC110530392 LOC106569206 coding downstream 217812 66437381 ~ 66509379 (+)
LOC110530393 LOC106569204 coding downstream 290856 66510425 ~ 66596240 (+)
LOC118965632 NA coding downstream 429065 66648634 ~ 66649552 (+)
LOC110530967 NA coding downstream 451534 66671103 ~ 66672607 (+)
G736608 NA non-coding upstream 52797 66166287 ~ 66166568 (+)
G736606 NA non-coding upstream 57917 66161238 ~ 66161448 (+)
G736578 NA non-coding upstream 111841 66107288 ~ 66107524 (+)
G736575 NA non-coding upstream 119690 66099467 ~ 66099675 (+)
G736572 NA non-coding upstream 121452 66097685 ~ 66097913 (+)
G736627 NA non-coding downstream 1666 66221235 ~ 66221687 (+)
G736659 NA non-coding downstream 49909 66269478 ~ 66274708 (+)
G736662 NA non-coding downstream 57315 66276884 ~ 66277084 (+)
G736663 NA non-coding downstream 58282 66277851 ~ 66278074 (+)
G736664 NA non-coding downstream 60189 66279758 ~ 66280027 (+)
LOC110530364 LOC106569228 other upstream 551270 65659289 ~ 65670369 (+)
LOC110530360 tmm70 other upstream 617468 65599331 ~ 65602141 (+)
G735512 NA other upstream 816266 65402223 ~ 65403099 (+)
si:ch211-207d6.2 kiaa1217 other upstream 870868 65300995 ~ 65386540 (+)
G737194 LOC106569203 other downstream 435093 66654662 ~ 66655753 (+)
kncn kncn other downstream 480117 66699211 ~ 66704200 (+)
G737234 gs02 other downstream 579004 66798573 ~ 66802080 (+)
G737783 NA other downstream 950898 67170467 ~ 67215629 (+)
G738020 NA other downstream 1011613 67231182 ~ 67231913 (+)

Expression


Co-expression Network