G746571



Basic Information


Item Value
gene id G746571
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 74479442 ~ 74479681 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU847463
tcgctctgttgttgaatggaccaaaagagaaacaaatctttcctactgatgagtcaacagggtcaacagaaggtaggctctgagggtcaggtcttgacatgttcctgaataacatagcaacacctgagggaatggcatctaaaacaattgcaaaatctttaggtgttacagggaccttgtaaagtgataagaattctttataactgagtaaaagaccctctgcatttaccagttggctca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU847463 True 240 lncRNA 0.41 1 74479442 74479681
Loading

Neighbor


gene id symbol gene type direction distance location
zgc:66427 LOC106569369 coding downstream 11986 74453594 ~ 74467456 (-)
si:ch211-284o19.8 LOC106569422 coding downstream 25974 74446837 ~ 74453468 (-)
mettl17 mettl17 coding downstream 47504 74428262 ~ 74431938 (-)
LOC110530579 NA coding downstream 52045 74426137 ~ 74427397 (-)
LOC110530578 NA coding downstream 55669 74422378 ~ 74423773 (-)
LOC110530585 NA coding upstream 49400 74529081 ~ 74532009 (-)
LOC110530586 LOC106569367 coding upstream 55922 74535603 ~ 74540854 (-)
LOC118965553 NA coding upstream 72591 74552272 ~ 74560559 (-)
LOC110530587 LOC106569365 coding upstream 86077 74565758 ~ 74624091 (-)
LOC100653464 LOC100653464 coding upstream 151616 74631297 ~ 74665700 (-)
G746524 NA non-coding downstream 116329 74362866 ~ 74363113 (-)
G746523 NA non-coding downstream 117057 74362119 ~ 74362385 (-)
G746522 NA non-coding downstream 117937 74361199 ~ 74361505 (-)
G746501 NA non-coding downstream 180841 74250884 ~ 74298601 (-)
G746595 NA non-coding upstream 30177 74509858 ~ 74510148 (-)
G746599 NA non-coding upstream 36705 74516386 ~ 74516593 (-)
G746601 NA non-coding upstream 38803 74518484 ~ 74519234 (-)
G746608 NA non-coding upstream 48671 74528352 ~ 74528677 (-)
G746592 NA non-coding upstream 62259 74541940 ~ 74547010 (-)
G746434 NA other downstream 119468 74342629 ~ 74359974 (-)
LOC110530984 NA other downstream 535012 73939248 ~ 73944430 (-)
G745292 c8 other downstream 1088009 73385652 ~ 73391433 (-)
G745300 NA other downstream 1097741 73381301 ~ 73381701 (-)
G744608 NA other downstream 1758975 72695048 ~ 72720467 (-)
G746730 NA other upstream 360050 74839731 ~ 74840090 (-)
G747266 NA other upstream 883061 75362742 ~ 75363491 (-)
G747337 NA other upstream 985399 75465080 ~ 75465616 (-)
LOC118965558 NA other upstream 1047754 75527435 ~ 75535384 (-)
LOC110530627 LOC106600212 other upstream 1098001 75576652 ~ 75578356 (-)

Expression


G746571 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G746571 Expression in each Bioproject

Bar chart with 18 bars.
G746571 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network