G747266



Basic Information


Item Value
gene id G747266
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 75362742 ~ 75363491 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU848338
acaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgtcaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagctggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacgtggccgtccctctaaactttcagctcatacaaggagaaggctgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaagtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggagctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattct

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU848338 True 750 TUCP 0.45 1 75362742 75363491

Neighbor


gene id symbol gene type direction distance location
LOC110530616 LOC106569427 coding downstream 286668 75070643 ~ 75076074 (-)
LOC110530618 slc7a8 coding downstream 294060 75049324 ~ 75068682 (-)
LOC110530615 LOC106569429 coding downstream 314380 75034055 ~ 75048362 (-)
LOC110530613 LOC106569433 coding downstream 331025 75029049 ~ 75031717 (-)
LOC110530612 LOC106569433 coding downstream 339752 75020372 ~ 75022990 (-)
LOC110530622 LOC106587759 coding upstream 88540 75452031 ~ 75457404 (-)
LOC118965557 NA coding upstream 136097 75499588 ~ 75503959 (-)
LOC118965558 NA coding upstream 169271 75527435 ~ 75535384 (-)
abhd4 LOC106569475 coding upstream 203378 75566869 ~ 75570627 (-)
LOC110530627 LOC106600212 coding upstream 213161 75576652 ~ 75578356 (-)
G747263 NA non-coding downstream 2969 75358582 ~ 75359773 (-)
G747269 LOC106569478 non-coding downstream 4784 75357421 ~ 75357958 (-)
G747258 LOC107676188 non-coding downstream 16160 75346327 ~ 75346582 (-)
G747255 NA non-coding downstream 22692 75339838 ~ 75340050 (-)
G747254 LOC106569478 non-coding downstream 23268 75339064 ~ 75339474 (-)
G747264 NA non-coding upstream 254 75363745 ~ 75368758 (-)
G747302 NA non-coding upstream 47108 75410599 ~ 75455872 (-)
G747312 NA non-coding upstream 61621 75425112 ~ 75440836 (-)
G747424 NA non-coding upstream 241893 75605384 ~ 75607235 (-)
LOC110530633 NA non-coding upstream 294008 75657415 ~ 75661619 (-)
G746730 NA other downstream 522652 74839731 ~ 74840090 (-)
G746434 NA other downstream 1002768 74342629 ~ 74359974 (-)
LOC110530984 NA other downstream 1418312 73939248 ~ 73944430 (-)
G745292 c8 other downstream 1971309 73385652 ~ 73391433 (-)
G745300 NA other downstream 1981041 73381301 ~ 73381701 (-)
G747337 NA other upstream 101589 75465080 ~ 75465616 (-)
G747442 NA other upstream 280804 75644295 ~ 75723894 (-)
G747956 NA other upstream 854416 76217907 ~ 76219312 (-)

Expression


G747266 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G747266 Expression in each Bioproject

Bar chart with 20 bars.
G747266 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network