G750491 (LOC106569543)



Basic Information


Item Value
gene id G750491
gene name LOC106569543
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 78715269 ~ 78715534 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU852024
TCGGCCCCATCCCCTGGGGGCAGAAGCTCATGGCCACAGCCTGCTGGAGGCTGGCGAGGGCCCCGACCCCGGATGGGCCTGCGGGGGAGAACATGCCCCCAGGGACGGAGGATGTCATGGACATGGTGCGGGGCCTCTGGAGGTCCACCAGCTTGACCATCTCACGGTCGTACTTAACAATCTCCTGGATCATCTCATTCTCATGGTTGTTGAAGACGCCGGAGTTGAGGTCGTGCTGCACTTTGTGCATCAGAATGGAGTTCTTC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU852024 True 266 lncRNA 0.61 1 78715269 78715534
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530703 LOC106569538 coding upstream 81191 78626521 ~ 78636077 (+)
plekhj1 plekhj1 coding upstream 105024 78607413 ~ 78610245 (+)
LOC110530701 LOC106569539 coding upstream 117502 78592298 ~ 78597767 (+)
onecut3b onecut3 coding upstream 353798 78335901 ~ 78361471 (+)
LOC110530995 LOC106569526 coding upstream 527220 78072559 ~ 78188049 (+)
LOC110530704 LOC106569544 coding downstream 100586 78816120 ~ 78824322 (+)
LOC110530706 LOC106569546 coding downstream 115151 78830685 ~ 78861909 (+)
LOC110530707 LOC106569548 coding downstream 179057 78894591 ~ 78902977 (+)
LOC110530709 LOC106569551 coding downstream 223646 78939180 ~ 78952258 (+)
LOC110531004 LOC106569564 coding downstream 240701 78956235 ~ 78959026 (+)
G750492 LOC106569543 non-coding upstream 75 78699830 ~ 78715194 (+)
G750474 NA non-coding upstream 50962 78664078 ~ 78664307 (+)
G750463 NA non-coding upstream 69594 78645112 ~ 78645675 (+)
G750426 NA non-coding upstream 131470 78583586 ~ 78583799 (+)
G750497 NA non-coding downstream 991 78716525 ~ 78716813 (+)
G750498 LOC106569543 non-coding downstream 1459 78716993 ~ 78717213 (+)
G750501 NA non-coding downstream 8173 78723707 ~ 78723909 (+)
G750503 NA non-coding downstream 13960 78729494 ~ 78729724 (+)
G750506 NA non-coding downstream 22968 78738502 ~ 78738762 (+)
G749663 tcf3 other upstream 469654 78244210 ~ 78245615 (+)
LOC110530993 LOC106569518 other upstream 827913 77863590 ~ 77887401 (+)
G749137 NA other upstream 1332658 77302737 ~ 77382611 (+)
G748959 LOC106569508 other upstream 1442609 77266652 ~ 77272660 (+)
G748917 NA other upstream 1535141 77179344 ~ 77180128 (+)
G750533 LOC106569543 other downstream 81608 78797142 ~ 78797548 (+)
G750854 NA other downstream 263696 78979230 ~ 78979981 (+)
G750935 NA other downstream 479736 79195270 ~ 79197378 (+)
ncana LOC106569686 other downstream 629903 79210727 ~ 79347454 (+)
LOC110530726 LOC106600567 other downstream 832963 79548127 ~ 79579010 (+)

Expression


G750491(LOC106569543) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.2.
End of interactive chart.

G750491(LOC106569543) Expression in each Bioproject

Bar chart with 2 bars.
G750491(LOC106569543) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.5.
End of interactive chart.

Co-expression Network