G752684



Basic Information


Item Value
gene id G752684
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 80807685 ~ 80810064 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU854666
ctagaggaatactgtgttagtgcagtctacagtaccctgataactagaggaatactgtgttagtgcagtaccctgataactagaggaatactgtgttagtgcagtctacagtaccctgataactagaggaatactgtgttagtgcagtaccctgataactagaggaatactgtgttagtgcagtacactgataactagaggaatactgtgttagtgcagtctacagtacactgataactagaggaatactgtgttagtgcagtctacagtaccctgataactagaggaatactgtgttagtgcagtaccctgataactagaggaatactgtgttagtgcagtctacagtaccctgataactagaggaatactgtgttagtgcagtaccctgataactagaggaatactgtgttagtgcagtctacagtaccctgataactagaggaatactgtgttagtgcagtacactgataactagagaaatactgtgttagtgcagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU854666 True 500 lncRNA 0.41 2 80807685 80810064

Neighbor


gene id symbol gene type direction distance location
LOC110530750 LOC106569642 coding downstream 44961 80760515 ~ 80762724 (-)
LOC118965620 NA coding downstream 77679 80703315 ~ 80730006 (-)
LOC110516601 NA coding downstream 155964 80638417 ~ 80651721 (-)
kcnab1b LOC106600589 coding downstream 191722 80531597 ~ 80615963 (-)
LOC118965562 NA coding upstream 116444 80926508 ~ 80938905 (-)
LOC110530802 LOC106569633 coding upstream 156169 80966233 ~ 80969248 (-)
LOC118965637 NA coding upstream 383009 81193073 ~ 81196197 (-)
LOC110531011 LOC106569569 coding upstream 392363 81202427 ~ 81333398 (-)
LOC110531012 LOC106569572 coding upstream 638671 81448735 ~ 81556398 (-)
G752682 NA non-coding downstream 104 80803369 ~ 80807581 (-)
G752668 NA non-coding downstream 50993 80756477 ~ 80756692 (-)
G752666 NA non-coding downstream 56040 80751417 ~ 80751645 (-)
G752653 NA non-coding downstream 74545 80732857 ~ 80733140 (-)
G752598 NA non-coding downstream 102123 80637854 ~ 80730101 (-)
G752687 NA non-coding upstream 2146 80812210 ~ 80820984 (-)
G752697 NA non-coding upstream 39231 80849295 ~ 80850226 (-)
G752703 NA non-coding upstream 54656 80864720 ~ 80866704 (-)
G752706 NA non-coding upstream 65835 80875899 ~ 80876113 (-)
G752709 NA non-coding upstream 69251 80879315 ~ 80879604 (-)
LOC110530730 LOC106569679 other downstream 878145 79928053 ~ 79929540 (-)
G751815 LOC106569680 other downstream 885324 79904880 ~ 79922361 (-)
G751667 LOC106569674 other downstream 1211666 79595142 ~ 79596019 (-)
G751668 NA other downstream 1226401 79578878 ~ 79581284 (-)
G752751 NA other upstream 169383 80979447 ~ 80979766 (-)
G752979 NA other upstream 401654 81211718 ~ 81212318 (-)
G754068 NA other upstream 631140 81441204 ~ 81442099 (-)

Expression


G752684 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G752684 Expression in each Bioproject

Bar chart with 16 bars.
G752684 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network