G756017



Basic Information


Item Value
gene id G756017
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 84389196 ~ 84390181 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU858727
actgtatatacagtgccttgcgaaagtattcggcccccttgaactctgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagccccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtctttggcagactccgtcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagggtgttgcttttacgccaaacataacattttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaaaaaatgtctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU858727 True 986 lncRNA 0.42 1 84389196 84390181

Neighbor


gene id symbol gene type direction distance location
tceanc2 tceanc2 coding upstream 436463 83950870 ~ 83952733 (+)
lrrc42 lrrc42 coding upstream 470289 83913983 ~ 83918907 (+)
LOC110530814 LOC106569707 coding upstream 485915 83895686 ~ 83905612 (+)
LOC110530812 zbt17 coding upstream 506473 83875531 ~ 83882723 (+)
LOC110530811 LOC106569621 coding upstream 517635 83846346 ~ 83871561 (+)
LOC110492646 LOC105022906 coding downstream 46307 84436488 ~ 84931644 (+)
LOC118965568 NA coding downstream 411092 84801273 ~ 84804572 (+)
LOC118965569 NA coding downstream 552793 84942974 ~ 84964998 (+)
LOC110531029 LOC106569826 coding downstream 576045 84966226 ~ 84970196 (+)
capsla capsl coding downstream 583416 84973597 ~ 84978102 (+)
G755995 NA non-coding upstream 12839 84374448 ~ 84376357 (+)
G755632 NA non-coding upstream 36598 84352319 ~ 84352598 (+)
G755631 NA non-coding upstream 38133 84350684 ~ 84351063 (+)
G755628 NA non-coding upstream 41293 84347619 ~ 84347903 (+)
G755624 NA non-coding upstream 49044 84339893 ~ 84340152 (+)
G756072 NA non-coding downstream 59003 84449184 ~ 84450948 (+)
G756082 NA non-coding downstream 81128 84471309 ~ 84475065 (+)
G756081 NA non-coding downstream 82053 84472234 ~ 84472885 (+)
G756126 NA non-coding downstream 153488 84543669 ~ 84543962 (+)
G756129 NA non-coding downstream 160313 84550494 ~ 84600254 (+)
G755602 NA other upstream 80922 84303470 ~ 84308274 (+)
G755585 NA other upstream 126230 84261987 ~ 84262966 (+)
G755428 NA other upstream 418499 83969378 ~ 83970697 (+)
G755363 NA other upstream 499559 83886814 ~ 83889637 (+)
G756134 NA other downstream 168605 84558786 ~ 84561891 (+)
G756271 NA other downstream 486813 84876994 ~ 84878079 (+)
G756298 NA other downstream 545885 84936066 ~ 84937744 (+)
LOC118965572 NA other downstream 866601 85256782 ~ 85264093 (+)
G757472 NA other downstream 1561787 85951968 ~ 86028274 (+)

Expression


G756017 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G756017 Expression in each Bioproject

Bar chart with 21 bars.
G756017 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network