G758751



Basic Information


Item Value
gene id G758751
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 87448538 ~ 87457099 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU862084
agggatgttttctgtttagtgagtcctccagatcagaggctagaagggatgaccagggatgttctctgtttagtgagtcctccagatcagatgctagaaggaatgaccagggatgttctctgtttagtgagtcctccagatcagaggctagaagggatgaccagggatgttctctgtttagtgagtcctccagatcagaggcagtaggaatgaccagggatgttctctgtttagtgagtcctccagatcagaggctagtagggatgaccagggatgttctctgtttagtgagtcctccagatcagaggctagaagggatgaccagggatgttctctgtttagtgagtcctccagatcagaggcagtaggaatgaccagggatgttctctgtttagtgagtcctccagatcagaggctagtagggatgaccagggatgttctctgtttagtgtgtcctccagatcagaggctagaagggattaccagggatgttctctgtttagtgagtcctccagataagaggcagtagggatgaccagggatgttctctgtttagtgagtcctccagatcagaggctagaagggatgaccagggatgtcctctgtttagtgagtcgtccagatcagaggcagtagggatggccagggatgttctctgtttagtgagtcctccagataagaggcagtagggatgaccagggatgttttctgtttagtgagtcctccagatcagaggctagaagggttgaccagggatgttctctgtttagtgagtcctccagatcagaggcagtaggggtggccagggatgttctctgtttagtgagtcctccagatcagaggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU862084 True 844 lncRNA 0.50 2 87448538 87457099

Neighbor


gene id symbol gene type direction distance location
LOC110517235 LOC106592571 coding downstream 495161 86920601 ~ 86953377 (-)
LOC110529151 LOC106569758 coding downstream 544583 86896684 ~ 86903955 (-)
LOC110531045 LOC106569759 coding downstream 555705 86873956 ~ 86892833 (-)
LOC118965578 NA coding downstream 574737 86868307 ~ 86873801 (-)
LOC110530853 LOC106569760 coding downstream 591080 86775438 ~ 86857458 (-)
LOC110517127 vapa coding upstream 337025 87794124 ~ 87824786 (-)
LOC110530881 LOC106569740 coding upstream 377575 87834674 ~ 87846312 (-)
ralbp1 ralbp1 coding upstream 392772 87849871 ~ 87876745 (-)
LOC110530873 LOC106596679 coding upstream 434127 87891226 ~ 87934005 (-)
LOC110530858 NA coding upstream 483709 87940808 ~ 87943613 (-)
G758738 NA non-coding downstream 9527 87394899 ~ 87439011 (-)
G758727 NA non-coding downstream 81332 87362375 ~ 87367206 (-)
G758677 NA non-coding downstream 200203 87247398 ~ 87248335 (-)
G758652 NA non-coding downstream 275057 87173082 ~ 87173481 (-)
G758638 NA non-coding downstream 340340 87107807 ~ 87108198 (-)
G758766 NA non-coding upstream 35990 87493089 ~ 87494372 (-)
G758773 NA non-coding upstream 49658 87506757 ~ 87507448 (-)
G758778 NA non-coding upstream 61448 87518547 ~ 87519086 (-)
G758794 NA non-coding upstream 91621 87548720 ~ 87550026 (-)
G758819 NA non-coding upstream 160377 87617476 ~ 87632612 (-)
G757788 NA other downstream 1216346 86230374 ~ 86308150 (-)
G757422 NA other downstream 1584651 85863011 ~ 85863887 (-)
G757292 LOC106569817 other downstream 1693300 85703130 ~ 85756434 (-)
G756981 NA other downstream 2033836 85413431 ~ 85414702 (-)
G757086 NA other downstream 2045011 85402618 ~ 85404005 (-)
G759421 NA other upstream 974105 88430998 ~ 88443468 (-)
G759982 NA other upstream 1078541 88535640 ~ 88536047 (-)
G759998 NA other upstream 1206505 88638913 ~ 88667229 (-)
G760051 NA other upstream 1245892 88702991 ~ 88704054 (-)

Expression


G758751 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G758751 Expression in each Bioproject

Bar chart with 17 bars.
G758751 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network