G759121 (rab12)


Basic Information

Item Value
gene id G759121
gene name rab12
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 88342406 ~ 88346482 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU862609
CGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGGTGTAGTCGAGGGGGATGTGGTGGAGAGTTGAGAGGGGAGTCATCTCAGCAACAGTGCATGCGTGGCGGGTTGAGCTCGGGAGGCACTTCTGGTTCAGGCTGCAGAGACAGGATGCTGTTGGAGAGCTTCCTGTTGGGAATCTCTAGAGGCATCTTTGCTAGAATGTCGTCCACTAGTTTTAGAAAGCACTCCTCCACGTTAAAGTTATCCTTGGCACTAGCCTCGCAGAAACGCATCCCAGATATCCTAGAGGTAAACTGGGAACCCGAGAGACATGATGATACC

Function

symbol description
rab12 Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in several processes, including cellular response to insulin stimulus; protein localization to plasma membrane; and secretion by cell. Predicted to act upstream of or within Rab protein signal transduction. Predicted to be active in Golgi apparatus; cytoplasmic vesicle; and plasma membrane. Is expressed in hindbrain; neural crest; and pharyngeal arch. Orthologous to human RAB12 (RAB12, member RAS oncogene family).

NR:

description
ras-related protein Rab-12

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU862609 True 399 lncRNA 0.57 2 88342406 88346482

Neighbor

gene id symbol gene type direction distance location
acss2l LOC106596660 coding upstream 282703 88017220 ~ 88059703 (+)
LOC110513441 apcdd1 coding upstream 566959 87745792 ~ 87775447 (+)
LOC110512127 LOC106591122 coding upstream 650663 87687931 ~ 87691743 (+)
LOC110512128 LOC106596732 coding upstream 671302 87569072 ~ 87671104 (+)
LOC110519501 LOC106569361 coding upstream 792568 87532950 ~ 87549838 (+)
LOC110510807 LOC106569716 coding downstream 278959 88625441 ~ 88642762 (+)
LOC110510805 LOC105030507 coding downstream 299918 88646400 ~ 88667320 (+)
LOC118965580 NA coding downstream 540352 88886834 ~ 88903834 (+)
slc25a24l LOC106569755 coding downstream 728142 89074624 ~ 89139486 (+)
fubp1 LOC106569753 coding downstream 748354 89094836 ~ 89113049 (+)
G759119 NA non-coding upstream 601 88340219 ~ 88341805 (+)
G759112 NA non-coding upstream 20603 88321183 ~ 88321803 (+)
G759099 NA non-coding upstream 36592 88302975 ~ 88305814 (+)
G759098 NA non-coding upstream 41322 88297923 ~ 88301084 (+)
G759091 NA non-coding upstream 58419 88282847 ~ 88283987 (+)
G759125 NA non-coding downstream 132 88346614 ~ 88347020 (+)
G759361 NA non-coding downstream 21305 88367787 ~ 88368157 (+)
G759365 NA non-coding downstream 25685 88372167 ~ 88372431 (+)
G759366 NA non-coding downstream 25963 88372445 ~ 88372919 (+)
G759370 NA non-coding downstream 27442 88373924 ~ 88374130 (+)
G759031 LOC106569827 other upstream 232106 88109006 ~ 88110300 (+)
G759020 LOC106569827 other upstream 235459 88082021 ~ 88106947 (+)
G758988 NA other upstream 347261 87991970 ~ 87995145 (+)
G758976 ankrd12 other upstream 370477 87959523 ~ 87971929 (+)
G758892 NA other upstream 465722 87875120 ~ 87876684 (+)
G759556 NA other downstream 351492 88697974 ~ 88701419 (+)
G759598 NA other downstream 514597 88861079 ~ 88861828 (+)
LOC118965583 LOC106569839 other downstream 1221521 89560138 ~ 89659347 (+)
G759892 NA other downstream 1349938 89696420 ~ 89696907 (+)

Expression


Co-expression Network