G759442



Basic Information


Item Value
gene id G759442
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 88476591 ~ 88477153 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU863032
cagcaggacagcaggacagcaggacagtaggacagtaggacagcaggacagtaaacagcaggacagtaggacaagaggacagtatacagtaggacagtaggacagcaggacagtatacagcaggacagtatacagcaggacagcacacagcaggacagtacacagcaggacagtatacagcaggacagtatacagcaggacagtaggacagtaggacagcaggacagtatacagc

Function


NR:

description
PREDICTED: protein lifeguard 1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU863032 True 235 lncRNA 0.51 2 88476591 88477153

Neighbor


gene id symbol gene type direction distance location
LOC110509139 rab12 coding downstream 114285 88342455 ~ 88362306 (-)
LOC110518901 LOC106596607 coding downstream 145096 88077201 ~ 88331495 (-)
LOC110530857 ndufv2 coding downstream 459488 88002853 ~ 88017103 (-)
LOC110531046 ankrd12 coding downstream 475471 87944259 ~ 88001120 (-)
LOC110530858 NA coding downstream 532978 87940808 ~ 87943613 (-)
LOC110530889 LOC103396682 coding upstream 194312 88671465 ~ 88819127 (-)
LOC110530888 LOC106569654 coding upstream 350918 88827984 ~ 88833229 (-)
pak1ip1 pak1ip1 coding upstream 357404 88834557 ~ 88846601 (-)
LOC110530885 LOC106569697 coding upstream 387408 88864561 ~ 88883016 (-)
LOC110530884 LOC106569698 coding upstream 428159 88905312 ~ 88919239 (-)
G759421 NA non-coding downstream 35963 88430998 ~ 88443468 (-)
G759422 NA non-coding downstream 38350 88432041 ~ 88438241 (-)
G759378 NA non-coding downstream 97252 88378973 ~ 88379339 (-)
G759371 NA non-coding downstream 102025 88374244 ~ 88374566 (-)
G759364 NA non-coding downstream 105805 88370002 ~ 88370786 (-)
G759446 NA non-coding upstream 11158 88488311 ~ 88491151 (-)
G759478 NA non-coding upstream 42899 88520052 ~ 88520659 (-)
G759479 NA non-coding upstream 44101 88521254 ~ 88521646 (-)
G759987 NA non-coding upstream 71363 88548516 ~ 88548864 (-)
G759989 NA non-coding upstream 72466 88549619 ~ 88550719 (-)
G757788 NA other downstream 2244399 86230374 ~ 86308150 (-)
G757422 NA other downstream 2612704 85863011 ~ 85863887 (-)
G757292 LOC106569817 other downstream 2721353 85703130 ~ 85756434 (-)
G759982 NA other upstream 58487 88535640 ~ 88536047 (-)
G759998 NA other upstream 186451 88638913 ~ 88667229 (-)
G760051 NA other upstream 225838 88702991 ~ 88704054 (-)
G760165 NA other upstream 539896 89017049 ~ 89017979 (-)

Expression


G759442 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G759442 Expression in each Bioproject

Bar chart with 10 bars.
G759442 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network