G759479



Basic Information


Item Value
gene id G759479
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 88521254 ~ 88521646 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU863073
CATATTGACAGTACTAGACAGAGCAGAGAAGCTCTCATATTGACAGTACTAGACAGAGCAGAGAAGCTCTCATATGGGCAGTACTAGACAGAGCAGAGGAGCTCTCATATTGACAGAAGTACAAGACAGAGCAGAGGAGCTCTCATATTGACAGTACTAGACAGAGCAGAGAAGCTCTCATATTGACAGTACTAGACAGAGCAGAGAAGCTCTCATATTGACAGTACTAGACAGAGCAGAGGAGCTCTCATATTGACAGCAGTACTAGACAGAGCAGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU863073 True 279 lncRNA 0.45 2 88521254 88521646

Neighbor


gene id symbol gene type direction distance location
LOC110509139 rab12 coding downstream 158948 88342455 ~ 88362306 (-)
LOC110518901 LOC106596607 coding downstream 189759 88077201 ~ 88331495 (-)
LOC110530857 ndufv2 coding downstream 504151 88002853 ~ 88017103 (-)
LOC110531046 ankrd12 coding downstream 520134 87944259 ~ 88001120 (-)
LOC110530858 NA coding downstream 577641 87940808 ~ 87943613 (-)
LOC110530889 LOC103396682 coding upstream 149819 88671465 ~ 88819127 (-)
LOC110530888 LOC106569654 coding upstream 306425 88827984 ~ 88833229 (-)
pak1ip1 pak1ip1 coding upstream 312911 88834557 ~ 88846601 (-)
LOC110530885 LOC106569697 coding upstream 342915 88864561 ~ 88883016 (-)
LOC110530884 LOC106569698 coding upstream 383666 88905312 ~ 88919239 (-)
G759478 NA non-coding downstream 595 88520052 ~ 88520659 (-)
G759446 NA non-coding downstream 30103 88488311 ~ 88491151 (-)
G759442 NA non-coding downstream 44101 88476591 ~ 88477153 (-)
G759421 NA non-coding downstream 80626 88430998 ~ 88443468 (-)
G759422 NA non-coding downstream 83013 88432041 ~ 88438241 (-)
G759987 NA non-coding upstream 26870 88548516 ~ 88548864 (-)
G759989 NA non-coding upstream 27973 88549619 ~ 88550719 (-)
G760001 NA non-coding upstream 69295 88590941 ~ 88597105 (-)
G760003 NA non-coding upstream 79338 88600984 ~ 88603305 (-)
G760012 NA non-coding upstream 99736 88621382 ~ 88621655 (-)
G757788 NA other downstream 2289062 86230374 ~ 86308150 (-)
G757422 NA other downstream 2657367 85863011 ~ 85863887 (-)
G757292 LOC106569817 other downstream 2766016 85703130 ~ 85756434 (-)
G759982 NA other upstream 13994 88535640 ~ 88536047 (-)
G759998 NA other upstream 141958 88638913 ~ 88667229 (-)
G760051 NA other upstream 181345 88702991 ~ 88704054 (-)
G760165 NA other upstream 495403 89017049 ~ 89017979 (-)

Expression


G759479 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G759479 Expression in each Bioproject

Bar chart with 5 bars.
G759479 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network