G759982



Basic Information


Item Value
gene id G759982
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 88535640 ~ 88536047 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU863742
TGTCATCTCTTCTTGGTGAAATCTGGATGATGTCATCTCCTCTTGGTGAAATCTGGATGATGTCATCTCTTCTTGGTGAAATTTGGATCATGTCATATCCTCTTGGTGAAATCTGGATGATGTCACCTCCTCTTGGTGAAATCTGGATGATGTCATATCCTCTTGGTGAAATGTGGACGATGTCATCTCCTCTTGGTGAAATCTGGATGATGTCACCTCTTCTTGGTGAAATCTGGATGATGTCATATCCTCTTGGTGAAATGTGGACGATGTCACCTCCTGTTGGTGAAATGTGAACGAAGTCACCTCCTCTTGGTGAAATGTGGACGATGTCATCTCCTCTTGGTG

Function


NR:

description
leucine-rich repeat extensin-like protein 3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU863742 True 348 TUCP 0.44 2 88535640 88536047
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509139 rab12 coding downstream 173334 88342455 ~ 88362306 (-)
LOC110518901 LOC106596607 coding downstream 204145 88077201 ~ 88331495 (-)
LOC110530857 ndufv2 coding downstream 518537 88002853 ~ 88017103 (-)
LOC110531046 ankrd12 coding downstream 534520 87944259 ~ 88001120 (-)
LOC110530858 NA coding downstream 592027 87940808 ~ 87943613 (-)
LOC110530889 LOC103396682 coding upstream 135418 88671465 ~ 88819127 (-)
LOC110530888 LOC106569654 coding upstream 292024 88827984 ~ 88833229 (-)
pak1ip1 pak1ip1 coding upstream 298510 88834557 ~ 88846601 (-)
LOC110530885 LOC106569697 coding upstream 328514 88864561 ~ 88883016 (-)
LOC110530884 LOC106569698 coding upstream 369265 88905312 ~ 88919239 (-)
G759479 NA non-coding downstream 13994 88521254 ~ 88521646 (-)
G759478 NA non-coding downstream 14981 88520052 ~ 88520659 (-)
G759446 NA non-coding downstream 44489 88488311 ~ 88491151 (-)
G759442 NA non-coding downstream 58487 88476591 ~ 88477153 (-)
G759421 NA non-coding downstream 95012 88430998 ~ 88443468 (-)
G759987 NA non-coding upstream 12469 88548516 ~ 88548864 (-)
G759989 NA non-coding upstream 13572 88549619 ~ 88550719 (-)
G760001 NA non-coding upstream 54894 88590941 ~ 88597105 (-)
G760003 NA non-coding upstream 64937 88600984 ~ 88603305 (-)
G760012 NA non-coding upstream 85335 88621382 ~ 88621655 (-)
G757788 NA other downstream 2303448 86230374 ~ 86308150 (-)
G757422 NA other downstream 2671753 85863011 ~ 85863887 (-)
G757292 LOC106569817 other downstream 2780402 85703130 ~ 85756434 (-)
G759998 NA other upstream 127557 88638913 ~ 88667229 (-)
G760051 NA other upstream 166944 88702991 ~ 88704054 (-)
G760165 NA other upstream 481002 89017049 ~ 89017979 (-)
G760182 LOC106569755 other upstream 543251 89079298 ~ 89081345 (-)

Expression


G759982 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G759982 Expression in each Bioproject

Bar chart with 1 bar.
G759982 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network