G760577



Basic Information


Item Value
gene id G760577
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 89981709 ~ 89982126 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU864583
tcgggctcaaacccaccgtcgctggaccggacaggactggcaaaaggtgctgttcactgacgagtcacggttttgtctcaccaggggtgatggtcggattcgcgttcatcgtcgaaggaatgagcattacactgaggcctgtactctggagcgggatcgatttggaggtggagggtccgtcatggtctggggcggtgtgtcacagcatcatcggactgagcttgttgtcattgcaggcaatctcaacgctgtgcgttacagggaagacatcctcctccctcatgtggtacacttcctgcaggctcttcctgacatgactctccaacatgacaatgccaccagccatactgctccttctgtgcgtgatttcctgcaagacaggaatgtcagtgttctgccatggccaacgaagagcccg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU864583 True 418 lncRNA 0.55 1 89981709 89982126

Neighbor


gene id symbol gene type direction distance location
LOC118965587 NA coding downstream 167453 89809305 ~ 89814256 (-)
LOC118965586 NA coding downstream 177772 89800462 ~ 89803937 (-)
LOC110530892 LOC106569833 coding downstream 190010 89773615 ~ 89791699 (-)
LOC110530894 LOC106569835 coding downstream 211703 89723665 ~ 89770006 (-)
LOC110530891 LOC106925954 coding downstream 274655 89637643 ~ 89707054 (-)
LOC110531063 LOC106591048 coding upstream 318941 90301067 ~ 90364204 (-)
orc2 orc2 coding upstream 695115 90677241 ~ 90694420 (-)
LOC110530878 LOC106569723 coding upstream 779233 90761359 ~ 90779222 (-)
bag1 LOC106569734 coding upstream 970866 90952992 ~ 90972453 (-)
LOC110512221 chmp5 coding upstream 1002456 90984582 ~ 91010533 (-)
G760575 NA non-coding downstream 5123 89975994 ~ 89976586 (-)
G760573 NA non-coding downstream 17149 89964268 ~ 89964560 (-)
G760568 rs8 non-coding downstream 23993 89951223 ~ 89957716 (-)
G760569 NA non-coding downstream 33087 89948340 ~ 89948622 (-)
G760567 NA non-coding downstream 33558 89947926 ~ 89948151 (-)
G760579 NA non-coding upstream 1260 89983386 ~ 89983918 (-)
G760580 NA non-coding upstream 5833 89987959 ~ 89990197 (-)
G760581 NA non-coding upstream 8138 89990264 ~ 89991002 (-)
G760585 NA non-coding upstream 16359 89998485 ~ 89998882 (-)
G760586 NA non-coding upstream 16832 89998958 ~ 89999604 (-)
G760362 NA other downstream 446356 89534623 ~ 89535353 (-)
LOC118965582 st6galnac5 other downstream 574207 89352710 ~ 89408042 (-)
G760306 NA other downstream 648933 89331281 ~ 89332776 (-)
G760192 LOC106569753 other downstream 879327 89099844 ~ 89102382 (-)
G760182 LOC106569755 other downstream 900364 89079298 ~ 89081345 (-)
G760971 NA other upstream 358686 90340812 ~ 90341303 (-)
G761034 NA other upstream 668270 90635679 ~ 90652740 (-)
G761176 NA other upstream 814021 90796147 ~ 90797574 (-)
G761467 NA other upstream 964353 90946479 ~ 90948106 (-)
G761504 NA other upstream 1073621 91055747 ~ 91111937 (-)

Expression


G760577 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G760577 Expression in each Bioproject

Bar chart with 21 bars.
G760577 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network