G760517



Basic Information


Item Value
gene id G760517
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 89998934 ~ 89999607 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU864509
atggcagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctattctctgagggtaatggcagaccctggctgtgaccctactctctgagggtaatggtagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactctctgagagtaatggtagaccctggctgtgaccctactctctgagggtaatggcagaccctggctgtgaccctactctctgagagtaatggtagaccctggctgtgaccctactctctgagagtaatggtagaccccggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactctctgagagtaatggtagaccctggctgtgaccctactctctgagggtaatggcagaccctggctgtgaccctactctctgagggtaatggcagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactctctgagggtaatggtagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactctctgagagtaatggcagaccctggctgtgaccctactc

Function


NR:

description
PREDICTED: protein FAM186A-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU864509 True 674 lncRNA 0.55 1 89998934 89999607

Neighbor


gene id symbol gene type direction distance location
rabggtb rabggtb coding upstream 7929 89975532 ~ 89991005 (+)
acadm acadm coding upstream 24670 89967509 ~ 89974264 (+)
rps8a rs8 coding upstream 41217 89951111 ~ 89957717 (+)
st6galnac3 LOC106591001 coding downstream 31417 90031024 ~ 90108312 (+)
LOC110515626 LOC108444490 coding downstream 229054 90228661 ~ 90295350 (+)
LOC110530899 LOC106569745 coding downstream 374464 90374071 ~ 90397563 (+)
LOC118965588 NA coding downstream 398992 90398599 ~ 90400473 (+)
LOC110517228 LOC106597294 coding downstream 440193 90439800 ~ 90545258 (+)
G760516 NA non-coding upstream 56 89998480 ~ 89998878 (+)
G760515 NA non-coding upstream 573 89997947 ~ 89998361 (+)
G760513 NA non-coding upstream 4224 89994474 ~ 89994710 (+)
G760511 NA non-coding upstream 18432 89979590 ~ 89980502 (+)
G760503 NA non-coding upstream 49297 89949135 ~ 89949637 (+)
G760524 NA non-coding downstream 39892 90039499 ~ 90040063 (+)
G760539 NA non-coding downstream 63228 90062835 ~ 90063102 (+)
G760552 NA non-coding downstream 96089 90095696 ~ 90097923 (+)
G760652 NA non-coding downstream 214948 90214555 ~ 90214853 (+)
G759892 NA other upstream 302027 89696420 ~ 89696907 (+)
LOC118965583 LOC106569839 other upstream 339587 89560138 ~ 89659347 (+)
slc25a24l LOC106569755 other upstream 904540 89074624 ~ 89139486 (+)
G759598 NA other upstream 1137106 88861079 ~ 88861828 (+)
G759556 NA other upstream 1297515 88697974 ~ 88701419 (+)
G760623 NA other downstream 160663 90160270 ~ 90208959 (+)
G760718 NA other downstream 374480 90362653 ~ 90400472 (+)
LOC110530875 rpl37a other downstream 700688 90700188 ~ 90709778 (+)
ndufb3 ndufb3 other downstream 737684 90737231 ~ 90743084 (+)
G760857 NA other downstream 770510 90770117 ~ 90771037 (+)

Expression


G760517 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G760517 Expression in each Bioproject

Bar chart with 7 bars.
G760517 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network