XLOC_026562 (ighv4-6)


Basic Information

Item Value
gene id XLOC_026562
gene name ighv4-6
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34092458 ~ 34092914 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00051745
TGCTTCTGATTGGATCAGGATCATTAACATCAGCCTCAAGATGAAGAATGCTCTCTGCTTACTGCTGCTCTTGTTAAGTCTACAGCGTATAAAATGTGAAAGTATGGAGTCAATTGAAAGCTCAGTGCAGAAAAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAGGATCCGGGTTCAGCTTTAGCTCCTATTACATGCACTGGATTAGACAACAAGCTGGAAAACCTCTTGTGTGGATTGGAGGCACTGGCTATGGCTATGCTGAGTCCTTCAAAGGAAGAGCTGAAATCACCAAAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTCACAGCAGAAGATTCAGCCGTGTATTACTGTGCAAGACAAT

Function

symbol description
ighv4-6 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0050871 positive regulation of B cell activation biological_process
GO:0006910 phagocytosis, recognition biological_process
GO:0006911 phagocytosis, engulfment biological_process
GO:0042742 defense response to bacterium biological_process
GO:0006958 complement activation, classical pathway biological_process
GO:0050853 B cell receptor signaling pathway biological_process
GO:0009897 external side of plasma membrane cellular_component
GO:0042571 immunoglobulin complex, circulating cellular_component
GO:0034987 immunoglobulin receptor binding molecular_function
GO:0003823 antigen binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030924-7 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

Ensembl:

ensembl_id ENSDARG00000096333

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00051745 True 380 mRNA 0.43 2 34092458 34092914

Neighbor

gene id symbol gene type direction distance location
XLOC_026561 si:dkey-204f11.13 coding downstream 1102 34091300 ~ 34091356 (-)
XLOC_026560 ighv4-7 coding downstream 2002 34089983 ~ 34090456 (-)
XLOC_026559 ighv4-8 coding downstream 5064 34086948 ~ 34087394 (-)
XLOC_026558 BX649502.11 coding downstream 5975 34086041 ~ 34086483 (-)
XLOC_026557 ighv4-9 coding downstream 7122 34084861 ~ 34085336 (-)
XLOC_026563 ighv6-1 coding upstream 2600 34095514 ~ 34103365 (-)
XLOC_026564 ighv4-5 coding upstream 3599 34096513 ~ 34096987 (-)
XLOC_026565 ighv5-3 coding upstream 5345 34098259 ~ 34098731 (-)
XLOC_026566 ighv5-2 coding upstream 8717 34101631 ~ 34102075 (-)
XLOC_026567 ighv5-1 coding upstream 13132 34106046 ~ 34106471 (-)
XLOC_026547 BX649502.5 non-coding downstream 27522 34063955 ~ 34064936 (-)
XLOC_026544 BX649502.10 non-coding downstream 33741 34058679 ~ 34058717 (-)
XLOC_026539 BX649502.4 non-coding downstream 43805 34048205 ~ 34048653 (-)
XLOC_026538 BX649502.6 non-coding downstream 44842 34047179 ~ 34047616 (-)
XLOC_026572 NA non-coding upstream 46723 34139637 ~ 34141181 (-)
XLOC_026580 NA non-coding upstream 548134 34641048 ~ 34641973 (-)
XLOC_026585 NA non-coding upstream 854488 34947402 ~ 34948061 (-)
XLOC_026588 NA non-coding upstream 1472214 35565128 ~ 35574451 (-)
XLOC_026600 NA non-coding upstream 2227325 36320239 ~ 36323625 (-)

Expression


Co-expression Network