rpl34 (rpl34)


Basic Information

Item Value
gene id rpl34
gene name rpl34
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 32494490 ~ 32498602 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_021615423.2
AGTTGAGGAAATATCCGGTGGTGAGAAAACTTAACATTTCAGAGCAACTTCTTTGGTTCTTCCTCTTCCGGTAACGGTAATATCAGGTATCAACATGGTCCAGCGCTTGACTTACCGTCGTAGGTTGTCCTACAACACTGCCTCCAACAAAACTAGGCTGTCCCGGACTCCTGGTAACCGCATTGTGTACCTGTACACCAAGAAGGTGGGCAAGGCCCCCAAGTCCGCATGCGGAATCTGCCCTGGTAGACTGCGCGGAATCCGGGCGGTGAGACCCCAGGTCCTGATGAGGCTCTCAAAAACCAAGAAGCACGTCAGCAGAGCCTACGGTGGAGCCATGTGTGCCAAGTGTGTGCGCGACCGGATCAAGCGAGCTTTCCTGATTGAGGAACAGAAGATCGTTGTCAAGGTTCTTAAGGCACAGGCACAGAGTCAGAAATCTAAGTAATTGTGTATTTGTACTGCTACAATAAAAGTCATTCAAGTCCA

Function

symbol description
rpl34 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in cytosol; endoplasmic reticulum; and ribosome. Is expressed in endodermal cell; intestine; liver; and pancreas. Orthologous to human RPL34 (ribosomal protein L34).

NR:

description
60S ribosomal protein L34

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02915 RP-L34e, RPL34; large subunit ribosomal protein L34e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_021615423.2 True 489 mRNA 0.50 5 32494490 32498602

Neighbor

gene id symbol gene type direction distance location
zgc:112271 bola2 coding upstream 369737 32122682 ~ 32124851 (+)
LOC110531922 LOC106577451 coding upstream 380191 32111792 ~ 32114299 (+)
LOC118965935 NA coding upstream 415767 32077618 ~ 32078723 (+)
LOC110531918 LOC106577443 coding upstream 467276 32002866 ~ 32027214 (+)
LOC110531917 LOC106608522 coding upstream 502094 31900060 ~ 31992396 (+)
ostc ostc coding downstream 21476 32520078 ~ 32539651 (+)
trnag-ucc-3 NA coding downstream 536343 33032239 ~ 33061120 (+)
trnag-ucc-4 NA coding downstream 536849 33035451 ~ 33035522 (+)
trnag-ucc-6 NA coding downstream 543990 33042592 ~ 33042663 (+)
trnag-ucc-7 NA coding downstream 545401 33044003 ~ 33044074 (+)
G794890 NA non-coding upstream 244 32494034 ~ 32494246 (+)
G794871 NA non-coding upstream 13589 32480669 ~ 32480901 (+)
G794860 NA non-coding upstream 18167 32476120 ~ 32476323 (+)
G794853 NA non-coding upstream 26128 32467902 ~ 32468362 (+)
G794847 NA non-coding upstream 28917 32465271 ~ 32465573 (+)
G794894 NA non-coding downstream 5156 32503758 ~ 32504005 (+)
G794912 NA non-coding downstream 42565 32541167 ~ 32542273 (+)
G794884 NA non-coding downstream 62915 32561517 ~ 32562743 (+)
G794932 NA non-coding downstream 128956 32627558 ~ 32651727 (+)
G794998 NA non-coding downstream 222018 32720620 ~ 32720875 (+)
LOC110531915 LOC106595846 other upstream 738045 31753182 ~ 31757502 (+)
G793757 LOC107579696 other upstream 897572 31595996 ~ 31596918 (+)
LOC110531891 NA other upstream 2206327 30282637 ~ 30288163 (+)
rbpjb LOC106577485 other upstream 3152287 29248127 ~ 29342203 (+)
G794892 NA other downstream 3245 32501847 ~ 32502355 (+)
G794893 NA other downstream 3794 32502396 ~ 32502749 (+)
G794886 LOC106577459 other downstream 85004 32583606 ~ 32587388 (+)
G796495 LOC106613263 other downstream 1622820 34121422 ~ 34121740 (+)
G797056 NA other downstream 2057329 34555931 ~ 34556622 (+)

Expression


Co-expression Network