trnap-agg-48



Basic Information


Item Value
gene id trnap-agg-48
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 33203274 ~ 33203345 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-48
ggctcgttggtctaggggtatgattctcgcttagggtgcgagaggtcccgggttcaaatcccggatgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-48 True 72 mRNA 0.60 1 33203274 33203345

Neighbor


gene id symbol gene type direction distance location
trnap-agg-47 NA coding downstream 2609 33200594 ~ 33200665 (-)
trnap-agg-46 NA coding downstream 4019 33199184 ~ 33199255 (-)
trnap-agg-45 NA coding downstream 5429 33197774 ~ 33197845 (-)
trnap-agg-44 NA coding downstream 21703 33181500 ~ 33181571 (-)
trnap-agg-43 NA coding downstream 23112 33180091 ~ 33180162 (-)
trnap-agg-49 NA coding upstream 5147 33208492 ~ 33208563 (-)
trnap-agg-50 NA coding upstream 6558 33209903 ~ 33209974 (-)
trnap-agg-51 NA coding upstream 8703 33212048 ~ 33212119 (-)
trnap-agg-52 NA coding upstream 22482 33225827 ~ 33225898 (-)
trnap-agg-53 NA coding upstream 23891 33227236 ~ 33227307 (-)
G795464 NA non-coding downstream 80007 33116205 ~ 33123267 (-)
G795461 NA non-coding downstream 105261 33096150 ~ 33098013 (-)
G795448 NA non-coding downstream 134555 33063170 ~ 33068719 (-)
G795456 NA non-coding downstream 136789 33046280 ~ 33066485 (-)
G795449 NA non-coding downstream 168519 33032351 ~ 33034755 (-)
G795474 NA non-coding upstream 32615 33235960 ~ 33236337 (-)
G795522 NA non-coding upstream 44897 33248242 ~ 33251310 (-)
LOC110531942 LOC106571840 non-coding upstream 80546 33283869 ~ 33318989 (-)
G795591 LOC106568774 non-coding upstream 131956 33335301 ~ 33335636 (-)
G795592 LOC106600668 non-coding upstream 132729 33336074 ~ 33336483 (-)
G794311 LOC106577443 other downstream 1175006 32026071 ~ 32028445 (-)
G793842 NA other downstream 1541076 31661239 ~ 31662198 (-)
G793489 NA other downstream 1784301 31418455 ~ 31418973 (-)
G793472 NA other downstream 1799405 31403482 ~ 31403869 (-)
G792267 NA other downstream 2845310 30315310 ~ 30357964 (-)
G796733 rl32 other upstream 847714 34051059 ~ 34057549 (-)
G797605 NA other upstream 1666610 34869955 ~ 34875879 (-)
G798195 NA other upstream 2150874 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 2182508 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 2288681 35492026 ~ 35521884 (-)

Expression


trnap-agg-48 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network