trnap-agg-52



Basic Information


Item Value
gene id trnap-agg-52
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 33225827 ~ 33225898 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-52
ggctcgttggtctaggggtatgattctcgcttagggtgcgagagggcccgggttcaaatcccggatgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-52 True 72 mRNA 0.61 1 33225827 33225898

Neighbor


gene id symbol gene type direction distance location
trnap-agg-51 NA coding downstream 13708 33212048 ~ 33212119 (-)
trnap-agg-50 NA coding downstream 15853 33209903 ~ 33209974 (-)
trnap-agg-49 NA coding downstream 17264 33208492 ~ 33208563 (-)
trnap-agg-48 NA coding downstream 22482 33203274 ~ 33203345 (-)
trnap-agg-47 NA coding downstream 25162 33200594 ~ 33200665 (-)
trnap-agg-53 NA coding upstream 1338 33227236 ~ 33227307 (-)
trnap-agg-54 NA coding upstream 5397 33231295 ~ 33231366 (-)
trnap-agg-55 NA coding upstream 6806 33232704 ~ 33232775 (-)
trnap-agg-56 NA coding upstream 7452 33233350 ~ 33233421 (-)
LOC110531942 LOC106571840 coding upstream 57971 33283869 ~ 33318989 (-)
G795464 NA non-coding downstream 102560 33116205 ~ 33123267 (-)
G795461 NA non-coding downstream 127814 33096150 ~ 33098013 (-)
G795448 NA non-coding downstream 157108 33063170 ~ 33068719 (-)
G795456 NA non-coding downstream 159342 33046280 ~ 33066485 (-)
G795449 NA non-coding downstream 191072 33032351 ~ 33034755 (-)
G795474 NA non-coding upstream 10062 33235960 ~ 33236337 (-)
G795522 NA non-coding upstream 22344 33248242 ~ 33251310 (-)
G795591 LOC106568774 non-coding upstream 109403 33335301 ~ 33335636 (-)
G795592 LOC106600668 non-coding upstream 110176 33336074 ~ 33336483 (-)
G794311 LOC106577443 other downstream 1197559 32026071 ~ 32028445 (-)
G793842 NA other downstream 1563629 31661239 ~ 31662198 (-)
G793489 NA other downstream 1806854 31418455 ~ 31418973 (-)
G793472 NA other downstream 1821958 31403482 ~ 31403869 (-)
G792267 NA other downstream 2867863 30315310 ~ 30357964 (-)
G796733 rl32 other upstream 825161 34051059 ~ 34057549 (-)
G797605 NA other upstream 1644057 34869955 ~ 34875879 (-)
G798195 NA other upstream 2128321 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 2159955 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 2266128 35492026 ~ 35521884 (-)

Expression


trnap-agg-52 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network