trnap-agg-53



Basic Information


Item Value
gene id trnap-agg-53
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 33227236 ~ 33227307 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-53
ggctcgttggtctaggggtatgattctcgcttagggtgcgagagggcccgggttcaaatcccggatgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-53 True 72 mRNA 0.61 1 33227236 33227307
Loading

Neighbor


gene id symbol gene type direction distance location
trnap-agg-52 NA coding downstream 1338 33225827 ~ 33225898 (-)
trnap-agg-51 NA coding downstream 15117 33212048 ~ 33212119 (-)
trnap-agg-50 NA coding downstream 17262 33209903 ~ 33209974 (-)
trnap-agg-49 NA coding downstream 18673 33208492 ~ 33208563 (-)
trnap-agg-48 NA coding downstream 23891 33203274 ~ 33203345 (-)
trnap-agg-54 NA coding upstream 3988 33231295 ~ 33231366 (-)
trnap-agg-55 NA coding upstream 5397 33232704 ~ 33232775 (-)
trnap-agg-56 NA coding upstream 6043 33233350 ~ 33233421 (-)
LOC110531942 LOC106571840 coding upstream 56562 33283869 ~ 33318989 (-)
LOC118966028 NA coding upstream 114544 33341652 ~ 33342845 (-)
G795464 NA non-coding downstream 103969 33116205 ~ 33123267 (-)
G795461 NA non-coding downstream 129223 33096150 ~ 33098013 (-)
G795448 NA non-coding downstream 158517 33063170 ~ 33068719 (-)
G795456 NA non-coding downstream 160751 33046280 ~ 33066485 (-)
G795449 NA non-coding downstream 192481 33032351 ~ 33034755 (-)
G795474 NA non-coding upstream 8653 33235960 ~ 33236337 (-)
G795522 NA non-coding upstream 20935 33248242 ~ 33251310 (-)
G795591 LOC106568774 non-coding upstream 107994 33335301 ~ 33335636 (-)
G795592 LOC106600668 non-coding upstream 108767 33336074 ~ 33336483 (-)
G794311 LOC106577443 other downstream 1198968 32026071 ~ 32028445 (-)
G793842 NA other downstream 1565038 31661239 ~ 31662198 (-)
G793489 NA other downstream 1808263 31418455 ~ 31418973 (-)
G793472 NA other downstream 1823367 31403482 ~ 31403869 (-)
G792267 NA other downstream 2869272 30315310 ~ 30357964 (-)
G796733 rl32 other upstream 823752 34051059 ~ 34057549 (-)
G797605 NA other upstream 1642648 34869955 ~ 34875879 (-)
G798195 NA other upstream 2126912 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 2158546 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 2264719 35492026 ~ 35521884 (-)

Expression


trnap-agg-53 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network