trnap-agg-55



Basic Information


Item Value
gene id trnap-agg-55
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 33232704 ~ 33232775 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-55
ggctcgttggtctaggggtatgattctcgcttagggtgcgagaggtcccgggttcaaatcccggatgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-55 True 72 mRNA 0.60 1 33232704 33232775
Loading

Neighbor


gene id symbol gene type direction distance location
trnap-agg-54 NA coding downstream 1338 33231295 ~ 33231366 (-)
trnap-agg-53 NA coding downstream 5397 33227236 ~ 33227307 (-)
trnap-agg-52 NA coding downstream 6806 33225827 ~ 33225898 (-)
trnap-agg-51 NA coding downstream 20585 33212048 ~ 33212119 (-)
trnap-agg-50 NA coding downstream 22730 33209903 ~ 33209974 (-)
trnap-agg-56 NA coding upstream 575 33233350 ~ 33233421 (-)
LOC110531942 LOC106571840 coding upstream 51094 33283869 ~ 33318989 (-)
LOC118966028 NA coding upstream 109076 33341652 ~ 33342845 (-)
LOC110531946 LOC106571846 coding upstream 546673 33779448 ~ 33801499 (-)
LOC110531948 LOC106571850 coding upstream 707660 33940435 ~ 33999008 (-)
G795464 NA non-coding downstream 109437 33116205 ~ 33123267 (-)
G795461 NA non-coding downstream 134691 33096150 ~ 33098013 (-)
G795448 NA non-coding downstream 163985 33063170 ~ 33068719 (-)
G795456 NA non-coding downstream 166219 33046280 ~ 33066485 (-)
G795449 NA non-coding downstream 197949 33032351 ~ 33034755 (-)
G795474 NA non-coding upstream 3185 33235960 ~ 33236337 (-)
G795522 NA non-coding upstream 15467 33248242 ~ 33251310 (-)
G795591 LOC106568774 non-coding upstream 102526 33335301 ~ 33335636 (-)
G795592 LOC106600668 non-coding upstream 103299 33336074 ~ 33336483 (-)
G794311 LOC106577443 other downstream 1204436 32026071 ~ 32028445 (-)
G793842 NA other downstream 1570506 31661239 ~ 31662198 (-)
G793489 NA other downstream 1813731 31418455 ~ 31418973 (-)
G793472 NA other downstream 1828835 31403482 ~ 31403869 (-)
G792267 NA other downstream 2874740 30315310 ~ 30357964 (-)
G796733 rl32 other upstream 818284 34051059 ~ 34057549 (-)
G797605 NA other upstream 1637180 34869955 ~ 34875879 (-)
G798195 NA other upstream 2121444 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 2153078 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 2259251 35492026 ~ 35521884 (-)

Expression


trnap-agg-55 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network