trnap-agg-56



Basic Information


Item Value
gene id trnap-agg-56
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 33233350 ~ 33233421 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-56
ggctcgttggtctaggggtatgattctcgcttagggtgcgagagggcccgggttcaaatcccggatgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-56 True 72 mRNA 0.61 1 33233350 33233421
Loading

Neighbor


gene id symbol gene type direction distance location
trnap-agg-55 NA coding downstream 575 33232704 ~ 33232775 (-)
trnap-agg-54 NA coding downstream 1984 33231295 ~ 33231366 (-)
trnap-agg-53 NA coding downstream 6043 33227236 ~ 33227307 (-)
trnap-agg-52 NA coding downstream 7452 33225827 ~ 33225898 (-)
trnap-agg-51 NA coding downstream 21231 33212048 ~ 33212119 (-)
LOC110531942 LOC106571840 coding upstream 50448 33283869 ~ 33318989 (-)
LOC118966028 NA coding upstream 108430 33341652 ~ 33342845 (-)
LOC110531946 LOC106571846 coding upstream 546027 33779448 ~ 33801499 (-)
LOC110531948 LOC106571850 coding upstream 707014 33940435 ~ 33999008 (-)
LOC110531949 LOC106571850 coding upstream 773531 34006952 ~ 34034490 (-)
G795464 NA non-coding downstream 110083 33116205 ~ 33123267 (-)
G795461 NA non-coding downstream 135337 33096150 ~ 33098013 (-)
G795448 NA non-coding downstream 164631 33063170 ~ 33068719 (-)
G795456 NA non-coding downstream 166865 33046280 ~ 33066485 (-)
G795449 NA non-coding downstream 198595 33032351 ~ 33034755 (-)
G795474 NA non-coding upstream 2539 33235960 ~ 33236337 (-)
G795522 NA non-coding upstream 14821 33248242 ~ 33251310 (-)
G795591 LOC106568774 non-coding upstream 101880 33335301 ~ 33335636 (-)
G795592 LOC106600668 non-coding upstream 102653 33336074 ~ 33336483 (-)
G794311 LOC106577443 other downstream 1205082 32026071 ~ 32028445 (-)
G793842 NA other downstream 1571152 31661239 ~ 31662198 (-)
G793489 NA other downstream 1814377 31418455 ~ 31418973 (-)
G793472 NA other downstream 1829481 31403482 ~ 31403869 (-)
G792267 NA other downstream 2875386 30315310 ~ 30357964 (-)
G796733 rl32 other upstream 817638 34051059 ~ 34057549 (-)
G797605 NA other upstream 1636534 34869955 ~ 34875879 (-)
G798195 NA other upstream 2120798 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 2152432 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 2258605 35492026 ~ 35521884 (-)

Expression


trnap-agg-56 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network