XLOC_026693 (mafk)


Basic Information

Item Value
gene id XLOC_026693
gene name mafk
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 42964045 ~ 42981739 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00051983
AGTTCAGGGAAACATTTCGCTTCGGTTGCAGGACGCGGGACGAGGCTCGACCTGTTGACTCCAGGACACTTTCTCAGAGTTTCTGCGCATCCCCGACACAGATTCCGCGTTCACAAGaCAGATTTTTGAAGAGTTCTGACTAGCTGCTTGTATGCAGGGCATGACGACTCATTTTAAAGCAGGCAAAGCTTTAAAGGTAAAGAAGGAGGCAGGTGAGAATGCTCCGGCGCTCAGCGACGATGAGCTGGTGGCCATGTCTGTGCGGGAGCTCAACCAGCACCTGCGCGGCTTGACCAAGGAAGACGTGGTGCGGCTGAAACAGCGGCGGCGCACGCTCAAGAACCGCGGATACGCTGCCAGCTGCCGCATCAAGCGCGTCACGCAGAAGGAGGAGCTTGAGCGGCAAAAGACGGAGCTGCAACACGAAGTGGACAAGCTGGCTCGAGAAAACGCCAGCATGCGACTGGAGCTGGACGCGCTTCGAGCTAAATACGAGGCCCTACAGTGCTTTGCCCGGACTGTCACCCGTGGGCCGCCCGGTAAAGTGGCTGCTACCAGTGTCATCACGATTGTCAAGTCTGCCAATCACAGCCCAAGCTCCGCCCCCTTTTCAGCACAATCGTAGTGCAGGCTGACAGTGCCAACCTGGTCCAATCTGGCTCTGAATCCAGACTGAATCTGAATCTGAGATGCTCGGGGTTCAGACTGACGGGATGGCGGACGCCTTCATCTACGCGACTACAACAGgctgcattcattttctttcatgtttttttttttttttttatactcatacacaaaatacatttatattgtcTGTGCACTGTGCTAGAAAGTCCGGCACCGGCAGGGCACGACGACCGCTATTTCCACAGGCTGAGCGTTAGCTGAGATGAGCACTTGTTGAAGAAGATACTTGATTTATGATATGGCAGCACTGGTCAGACAGCTCTGTGACATATTACATATGCAttggaaatattttatatatcttACGTAATAATTATTCctatatattacaaaaatatatagtatAGCACTCAGATGGTTGAGGTCAGTAAGATATGATGCAattttgttatatataatatattcagCAGCAAATGTAGCTTtgttgtcatttaaataaattataatttaacgCATTCAAAGAGGAAACTTTTTAAACTATTCCATACAGTGGcagagagagcttaatgtgctgcaatttaggggtgctttcacacctgtagatcgattgttttgttccaaaacagggcTTATAACCATTactgtgttgctctttgttcttggtgtggttggctttcacacagcaaagtttctaaatggaccaaaatagctaaaa
>TCONS_00051984
ACTAGCTGCTTGTATGCAGGGCATGACGACTCATTTTAAAGCAGGCAAAGCTTTAAAGGTAAAGAAGGAGGCAGGTGAGAATGCTCCGGCGCTCAGCGACGATGAGCTGGTGGCCATGTCTGTGCGGGAGCTCAACCAGCACCTGCGCGGCTTGACCAAGGAAGACGTGGTGCGGCTGAAACAGCGGCGGCGCACGCTCAAGAACCGCGGATACGCTGCCAGCTGCCGCATCAAGCGCGTCACGCAGAAGGAGGAGCTTGAGCGGCAAAAGACGGAGCTGCAACACGAAGTGGACAAGCTGGCTCGAGAAAACGCCAGCATGCGACTGGAGCTGGACGCGCTTCGAGCTAAATACGAGGCCCTACAGTGCTTTGCCCGGACTGTCACCCGTGGGCCGCCCGGTAAAGTGGCTGCTACCAGTGTCATCACGATTGTCAAGTCTGCCAATCACAGCCCAAGCTCCGCCCCCTTTTCAGCACAATCGTAGTGCAGGCTGACAGTGCCAACCTGGTCCAATCTGGCTCTGAATCCAGACT

Function

symbol description
mafk Enables protein heterodimerization activity and transcription cis-regulatory region binding activity. Contributes to DNA-binding transcription factor activity. Acts upstream of or within positive regulation of transcription, DNA-templated and transcription, DNA-templated. Part of transcription regulator complex. Is expressed in exocrine pancreas. Orthologous to human MAFK (MAF bZIP transcription factor K).

GO:

id name namespace
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0005667 transcription regulator complex cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040624-9 Enables protein heterodimerization activity and transcription cis-regulatory region binding activity. Contributes to DNA-binding transcription factor activity. Acts upstream of or within positive regulation of transcription, DNA-templated and transcription, DNA-templated. Part of transcription regulator complex. Is expressed in exocrine pancreas. Orthologous to human MAFK (MAF bZIP transcription factor K).

Ensembl:

ensembl_id ENSDARG00000100947

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00051983 False 1345 mRNA 0.47 3 42964045 42981739
TCONS_00051984 True 536 mRNA 0.58 2 42964716 42967698

Neighbor

gene id symbol gene type direction distance location
XLOC_026691 CABZ01079183.1 coding downstream 97845 42866083 ~ 42866200 (-)
XLOC_026690 NA coding downstream 217261 42548944 ~ 42746784 (-)
XLOC_026689 NA coding downstream 590446 42371784 ~ 42373599 (-)
XLOC_026688 BX005183.3 coding downstream 748032 42212710 ~ 42216013 (-)
XLOC_026687 NA coding downstream 758933 42183353 ~ 42205112 (-)
XLOC_026694 NA coding upstream 43082 43024821 ~ 43026735 (-)
XLOC_026695 NA coding upstream 205455 43187194 ~ 43189085 (-)
XLOC_026696 snn coding upstream 365778 43347517 ~ 43821381 (-)
XLOC_026697 uncx coding upstream 370817 43352556 ~ 43356082 (-)
XLOC_026698 axin1 coding upstream 597236 43578975 ~ 43686469 (-)
XLOC_026702 BX682557.2 non-coding upstream 885046 43866785 ~ 43875129 (-)
XLOC_026703 BX682557.1 non-coding upstream 896717 43878456 ~ 43889443 (-)
XLOC_026708 NA non-coding upstream 1129806 44111545 ~ 44124370 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00018084 mafk coding CM030135.1 CM030135.1 1262029 ~ 1265534 (+)