G766888



Basic Information


Item Value
gene id G766888
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 6767779 ~ 6791013 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU873260
tttctggattttgaaaattagtgggtatcggcctaattctgctctgcatgcattatttggtgttctacgttgtacacggaggatatttttgcagaattctgctgtttggtgtttgtcccattttgtgaagtcttggttggtgagcggaccccagacctcacaaccataaagggcaatgggctctatgactgattcaagtatttttagccagatcctaattggtatgttgaattttattttccttttgatggcatagaaggcccttcttgccttgtctctcagatcgttcacagctttgtggaagttacctgtggcgctgatgtttaggccaaggtatgtatagttttttgtgtgctctagggcaacagtgtctagatggaatttgtatttgtggtcttggctactggaccttttttggaacaccattatttttgtcttactgagatttactgtcagggcccaggtctgacagtatctgtgcagaagatctaggtgctgctgtaggccctccttggttggtgacagaagcaccagatcatcagcaaacagcagacatttgacttcggattct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU873260 True 571 lncRNA 0.43 2 6767779 6791013

Neighbor


gene id symbol gene type direction distance location
badb LOC106578087 coding downstream 232028 6533163 ~ 6535751 (-)
LOC110532903 LOC106578061 coding downstream 242444 6500762 ~ 6525335 (-)
gpha2 LOC106578061 coding downstream 276822 6481631 ~ 6490957 (-)
arl2 arl2 coding downstream 358211 6407522 ~ 6409568 (-)
LOC118966206 NA coding downstream 404727 6362989 ~ 6363052 (-)
LOC110531366 LOC106578102 coding upstream 60184 6851197 ~ 6882912 (-)
LOC110531364 LOC106578119 coding upstream 94982 6885995 ~ 6907134 (-)
LOC118966154 NA coding upstream 163979 6954992 ~ 6957780 (-)
LOC110531380 LOC106578126 coding upstream 172129 6963142 ~ 6969857 (-)
LOC110531367 LOC106578116 coding upstream 179845 6970858 ~ 7054255 (-)
G766880 NA non-coding downstream 31804 6735650 ~ 6735975 (-)
LOC110510780 plcb3 non-coding downstream 36974 6636026 ~ 6834904 (-)
G766832 NA non-coding downstream 39018 6682744 ~ 6728761 (-)
G766876 NA non-coding downstream 71286 6694303 ~ 6696493 (-)
G766878 NA non-coding downstream 74168 6692979 ~ 6693611 (-)
G766897 NA non-coding upstream 1333 6792346 ~ 6793178 (-)
G766899 NA non-coding upstream 3766 6794779 ~ 6802950 (-)
G766903 NA non-coding upstream 26966 6817979 ~ 6820397 (-)
G766904 NA non-coding upstream 27383 6818396 ~ 6819889 (-)
G766915 NA non-coding upstream 63763 6854776 ~ 6855625 (-)
G766850 LOC106578109 other downstream 154367 6612079 ~ 6613412 (-)
G766749 NA other downstream 303148 6457203 ~ 6464631 (-)
G766665 NA other downstream 402251 6340621 ~ 6365895 (-)
G766640 NA other downstream 511151 6251597 ~ 6262155 (-)
G766599 LOC106578100 other downstream 558570 6201369 ~ 6209209 (-)
G767056 ovol1 other upstream 454631 7245644 ~ 7251075 (-)
LOC110510419 LOC106560462 other upstream 1321575 8112588 ~ 8155916 (-)
G768390 NA other upstream 1398430 8189443 ~ 8191898 (-)

Expression


G766888 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G766888 Expression in each Bioproject

Bar chart with 19 bars.
G766888 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network