G768863



Basic Information


Item Value
gene id G768863
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 9178560 ~ 9178813 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU875844
cattaacatgatgctttatctggacatggttcaacaggacctccaccagccgaagctaagtagtaacattaacatgatgctttatctggacatggttcaacaggacctccaccagccgaagctaagtagtaacatttacatgatgctttatctggacatggttcgtcaggacctccatcagccgaagctaagtagtaacattaacatgtacttgcagtcgctgtactcataatatacaggagaacgatcgcctt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU875844 True 254 lncRNA 0.43 1 9178560 9178813
Loading

Neighbor


gene id symbol gene type direction distance location
bmp15 LOC106578107 coding downstream 71101 9104234 ~ 9107459 (-)
leap2 leap-2a coding downstream 91263 9083247 ~ 9145704 (-)
phka1a LOC106578056 coding downstream 101197 9023713 ~ 9077363 (-)
LOC118966157 NA coding downstream 461222 8702038 ~ 8717338 (-)
LOC110532904 m1ap coding downstream 493589 8639499 ~ 8684971 (-)
LOC110531417 LOC106578044 coding upstream 115951 9294764 ~ 9348258 (-)
LOC110531429 LOC106578053 coding upstream 804679 9983492 ~ 9988450 (-)
LOC118965989 NA coding upstream 938947 10116536 ~ 10130445 (-)
LOC118965990 NA coding upstream 956716 10135529 ~ 10137709 (-)
LOC110531425 LOC106578047 coding upstream 961810 10140623 ~ 10213285 (-)
G768861 NA non-coding downstream 4261 9174086 ~ 9174299 (-)
G768853 NA non-coding downstream 33948 9143969 ~ 9144612 (-)
G768819 NA non-coding downstream 97987 9080327 ~ 9080573 (-)
G768810 NA non-coding downstream 127215 9049892 ~ 9051345 (-)
G768865 NA non-coding upstream 1600 9180413 ~ 9180925 (-)
G768867 NA non-coding upstream 4657 9183470 ~ 9183815 (-)
G768868 NA non-coding upstream 5032 9183845 ~ 9184349 (-)
G768869 NA non-coding upstream 6177 9184990 ~ 9185444 (-)
G768878 NA non-coding upstream 21196 9200009 ~ 9201756 (-)
G768780 NA other downstream 187854 8982468 ~ 8990706 (-)
LOC110531377 LOC106578102 other downstream 895236 8277882 ~ 8283359 (-)
LOC118936684 LOC106578100 other downstream 925805 8221531 ~ 8253809 (-)
G768390 NA other downstream 986662 8189443 ~ 8191898 (-)
LOC110510419 LOC106560462 other downstream 1064490 8112588 ~ 8155916 (-)
G770225 NA other upstream 1195896 10367459 ~ 10375854 (-)
G770549 NA other upstream 1793560 10972373 ~ 10974413 (-)
G770627 LOC106577876 other upstream 1929015 11107828 ~ 11108159 (-)
G771457 NA other upstream 2449803 11628616 ~ 11629588 (-)
LOC110531452 LOC106577886 other upstream 2519586 11698392 ~ 11701613 (-)

Expression


G768863 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G768863 Expression in each Bioproject

Bar chart with 16 bars.
G768863 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network