G769489 (LOC107579696)



Basic Information


Item Value
gene id G769489
gene name LOC107579696
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 10321983 ~ 10322734 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU876560
cccccggggtagactatactctctgtcggctcccgaacgtaaggctctcgaggattatttgtctgtagctcttgacgccggtaccatagtcccctcctcctctcccgccggagcggggtttttttttgtccagaagaaggacgggtctctgcgcccctgcatagattatcgagggctgaatgacataacagttaagaatcgttatccgcttcctcttatgtcttcagccttcgagatcctgcagggagccaggtttttcactaagttggaccttcgtaacgcttaccatctcgtgcgcatcagggagggggacgagtggaagacggcgtttaacactccgttagggcactttgaataccgggttcttcctttcggcctcgctaacgctccagctgtctttcaggcattagtcaatgatgtcctgagagacatgctgaacatctttgttttcgtttaccttgacgatatcctgattttttcaccgtcactccagattcatcttcagcacgttcgacgtgtcctccagcgccttttagagaattgtctttttgtgaaggctgagaagtgcacttttcatgcctcctccgtcacatttctcggttctgttatttccgctgaaggcattaagatggatcccgctaaggtccaagctgtcattgattggcccgcccctaagtcacgcgtcgagctgcagcgctttctcggcttcgcgaacttctatcgtcgtttcatccgtaatttcggtcaggtgg

Function


NR:

description
PREDICTED: uncharacterized protein LOC109045530

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU876560 True 752 TUCP 0.51 1 10321983 10322734

Neighbor


gene id symbol gene type direction distance location
LOC110532990 hdac8 coding upstream 5242 10315424 ~ 10316741 (+)
LOC110531430 NA coding upstream 15263 10284263 ~ 10306720 (+)
LOC118965992 LOC106578050 coding upstream 46976 10262294 ~ 10275007 (+)
LOC110531435 LOC106578049 coding upstream 67111 10249245 ~ 10254872 (+)
LOC110531426 LOC106578051 coding upstream 205622 10035349 ~ 10116361 (+)
LOC110531421 LOC106578079 coding downstream 37002 10359736 ~ 10365323 (+)
LOC110531420 LOC106578040 coding downstream 44680 10367414 ~ 10375853 (+)
LOC118966239 NA coding downstream 48075 10370809 ~ 10370884 (+)
LOC118966238 NA coding downstream 52447 10375181 ~ 10375315 (+)
LOC110531424 nhsl2 coding downstream 64040 10386774 ~ 10524429 (+)
G769473 NA non-coding upstream 38900 10282493 ~ 10283083 (+)
G769463 NA non-coding upstream 60395 10261243 ~ 10261588 (+)
G769462 NA non-coding upstream 61144 10260627 ~ 10260839 (+)
G769454 NA non-coding upstream 62173 10246838 ~ 10259810 (+)
G769490 LOC105416325 non-coding downstream 125 10322859 ~ 10323102 (+)
G769491 NA non-coding downstream 394 10323128 ~ 10323579 (+)
G769494 NA non-coding downstream 7022 10329756 ~ 10330025 (+)
G769512 NA non-coding downstream 44264 10366998 ~ 10413987 (+)
G769537 NA non-coding downstream 77075 10399809 ~ 10400463 (+)
G769335 NA other upstream 340729 9980226 ~ 9981254 (+)
G768321 NA other upstream 1089497 9232160 ~ 9232486 (+)
G768265 NA other upstream 1092286 9228194 ~ 9229697 (+)
si:dkey-183c6.7 ut1 other upstream 1331431 8958261 ~ 8990700 (+)
G768161 NA other upstream 1444401 8876434 ~ 8877582 (+)
G769681 NA other downstream 362403 10685137 ~ 10686022 (+)
G769713 NA other downstream 460357 10783091 ~ 10783408 (+)
LOC110531469 LOC106577901 other downstream 2004292 12317006 ~ 12406007 (+)
G772033 LOC106577932 other downstream 2615728 12938462 ~ 12963571 (+)
LOC110531509 tmm85 other downstream 2764297 13087000 ~ 13095070 (+)

Expression


G769489(LOC107579696) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G769489(LOC107579696) Expression in each Bioproject

Bar chart with 20 bars.
G769489(LOC107579696) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network