G771881



Basic Information


Item Value
gene id G771881
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 12482765 ~ 12482986 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU879397
aaaaagaaacgtcctctcactgtcaactgtgtttattttcagcaaacttaacatgtgtaaatatttgtatgaacataagattcaacaactgagacataaactgaacaagttccacagacatgtgactaacagaaattgaataatgtgtccctaaaaagggggggtaaaaatcaaaagtaacagtccgtatctggtgtggccactagctgcattaagtactgc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU879397 True 222 lncRNA 0.36 1 12482765 12482986
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531474 LOC106577903 coding upstream 63421 12414530 ~ 12419344 (+)
LOC110531473 LOC106577902 coding upstream 68302 12408655 ~ 12414463 (+)
LOC110531469 LOC106577901 coding upstream 79669 12317006 ~ 12406007 (+)
mblac1 mblac1 coding upstream 173363 12292522 ~ 12309402 (+)
LOC110531457 LOC106608950 coding upstream 199798 12263395 ~ 12282967 (+)
LOC110531479 NA coding downstream 24806 12507792 ~ 12511770 (+)
LOC110531483 LOC106577922 coding downstream 100544 12583530 ~ 12592900 (+)
LOC110531486 LOC106577911 coding downstream 155055 12638041 ~ 12675811 (+)
LOC110531488 NA coding downstream 225661 12708647 ~ 12715530 (+)
LOC110531490 NA coding downstream 266772 12749758 ~ 12760750 (+)
G771878 NA non-coding upstream 7126 12468815 ~ 12475639 (+)
G771395 NA non-coding upstream 39727 12386877 ~ 12443038 (+)
G771379 NA non-coding upstream 167642 12314873 ~ 12315123 (+)
G771378 NA non-coding upstream 168824 12313694 ~ 12313941 (+)
G771882 NA non-coding downstream 144 12483130 ~ 12483465 (+)
G771883 NA non-coding downstream 668 12483654 ~ 12483961 (+)
G771884 NA non-coding downstream 1269 12484255 ~ 12484531 (+)
G771885 LOC106577906 non-coding downstream 19988 12502974 ~ 12506703 (+)
G771904 NA non-coding downstream 60634 12543620 ~ 12544009 (+)
G769713 NA other upstream 1699357 10783091 ~ 10783408 (+)
G769681 NA other upstream 1796743 10685137 ~ 10686022 (+)
G769489 LOC107579696 other upstream 2160031 10321983 ~ 10322734 (+)
G769335 NA other upstream 2501511 9980226 ~ 9981254 (+)
G772033 LOC106577932 other downstream 455476 12938462 ~ 12963571 (+)
LOC110531509 tmm85 other downstream 604045 13087000 ~ 13095070 (+)
G772241 LOC106577945 other downstream 908811 13391797 ~ 13392721 (+)
LOC110531525 LOC106577958 other downstream 1168336 13651265 ~ 13667682 (+)
G772402 LOC106577959 other downstream 1188824 13671810 ~ 13710443 (+)

Expression


G771881 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G771881 Expression in each Bioproject

Bar chart with 20 bars.
G771881 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network