G772239 (LOC106577950)



Basic Information


Item Value
gene id G772239
gene name LOC106577950
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 13386349 ~ 13386568 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU879813
GAAACAGGCAAAATGTGGCAGATGCACTTCTTCCAGTTCTCCTGCAATGATTGTGACGTCCAATAGGGGGCCTCCTTGCTTGTACCCCAAGCTTTTCATCATTGCACTGTGAGGTTCCCAGGAGCTGAATTGATACTGCAGACTGACGTGGTCTTTACACACCCATCGGAGCCCTGATACTCTGCACTCGTAGCGCCCCGGGGGAGACATGCTAGGTACG

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU879813 True 220 lncRNA 0.53 1 13386349 13386568

Neighbor


gene id symbol gene type direction distance location
LOC110531503 LOC106577949 coding upstream 10482 13366370 ~ 13375867 (+)
LOC118966160 LOC106577945 coding upstream 62458 13321306 ~ 13323891 (+)
LOC110532923 LOC106577978 coding upstream 76334 13299386 ~ 13310015 (+)
LOC110532922 LOC106577946 coding upstream 99524 13217467 ~ 13286825 (+)
LOC110531513 LOC106577942 coding upstream 187248 13179911 ~ 13199101 (+)
LOC110531519 LOC106577953 coding downstream 172807 13559375 ~ 13592005 (+)
LOC110531521 NA coding downstream 211784 13598352 ~ 13602342 (+)
LOC110531520 LOC106577955 coding downstream 215823 13602391 ~ 13611243 (+)
LOC110531525 LOC106577958 coding downstream 264697 13651265 ~ 13667682 (+)
LOC118966141 LOC106577961 coding downstream 295728 13682296 ~ 13694583 (+)
G772189 NA non-coding upstream 133817 13252251 ~ 13252532 (+)
G772175 NA non-coding upstream 156849 13228857 ~ 13229500 (+)
G772172 NA non-coding upstream 166958 13219151 ~ 13219391 (+)
G772171 NA non-coding upstream 167844 13217860 ~ 13218505 (+)
G772245 NA non-coding downstream 11412 13397980 ~ 13398328 (+)
G772253 NA non-coding downstream 24315 13410883 ~ 13411161 (+)
G772273 NA non-coding downstream 56028 13442596 ~ 13442803 (+)
G772264 NA non-coding downstream 89926 13476494 ~ 13488497 (+)
G772293 NA non-coding downstream 103082 13489650 ~ 13490426 (+)
LOC110531509 tmm85 other upstream 291279 13087000 ~ 13095070 (+)
G772033 LOC106577932 other upstream 422778 12938462 ~ 12963571 (+)
LOC110531469 LOC106577901 other upstream 980342 12317006 ~ 12406007 (+)
G769713 NA other upstream 2602941 10783091 ~ 10783408 (+)
G769681 NA other upstream 2700327 10685137 ~ 10686022 (+)
G772241 LOC106577945 other downstream 5229 13391797 ~ 13392721 (+)
G772402 LOC106577959 other downstream 285242 13671810 ~ 13710443 (+)
G772540 NA other downstream 531434 13918002 ~ 14018373 (+)
G773437 NA other downstream 638305 14024873 ~ 14028528 (+)

Expression


G772239(LOC106577950) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G772239(LOC106577950) Expression in each Bioproject

Bar chart with 3 bars.
G772239(LOC106577950) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network